![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 14, No. 2, pp. 245-254, January 15, 2000
1 Department of Molecular Biology, Göteborg University, The Lundberg Laboratory, Medicinaregatan 9C, Box 462, S-405 30 Göteborg, Sweden; 2 Department of Developmental Biology, Medical School, University of Tampere, Tampere, Finland
 |
Abstract |
|---|
 Top
 Abstract
 Introduction
Results
Discussion
Materials and methods
References
|
|---|
In the mouse mutant dysgenetic lens (dyl) the lens vesicle fails to separate from the ectoderm, causing a fusion between the lens and the cornea. Lack of a proliferating anterior lens epithelium leads to absence of secondary lens fibers and a dysplastic, cataractic lens. We report the cloning of a gene, FoxE3, encoding a forkhead/winged helix transcription factor, which is expressed in the developing lens from the start of lens placode induction and becomes restricted to the anterior proliferating cells when lens fiber differentiation begins. We show that FoxE3 is colocalized with dyl in the mouse genome, that dyl mice have mutations in the part of FoxE3 encoding the DNA-binding domain, and that these mutations cosegregate with the dyl phenotype. During embryonic development, the primordial lens epithelium is formed in an apparently normal way in dyl mutants. However, instead of the proliferation characteristic of a normal lens epithelium, the posterior of these cells fail to divide and show signs of premature differentiation, whereas the most anterior cells are eliminated by apoptosis. This implies that FoxE3 is essential for closure of the lens vesicle and is a factor that promotes survival and proliferation, while preventing differentiation, in the lens epithelium.
[Key Words: forkhead; lens epithelium; dysgenetic lens; FoxE3; cataract]
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Results
Discussion
Materials and methods
References
|
|---|
Lens formation during vertebrate eye development is a classic
example of induction. (Spemann 1901
) The optic
vesicle
an outgrowth from the ventral forebrain that later forms the
retinainduces the surface ectoderm to invaginate and bud off the lens
vesicle. A polarity soon develops in the primitive lens; posterior
cells differentiate into elongated, crystallin-expressing, primary lens fibers that gradually fill the vesicle, whereas the anterior surface retains a layer of undifferentiated, proliferating cells. These cells
of the anterior lens epithelium continue to divide throughout life and
as they migrate posteriorly into the equatorial region of the lens,
they start to differentiate into secondary lens fibers (McAvoy 1980;
Piatigorsky 1981).
Several transcription factors are essential for lens development. The
homeodomain proteins Lhx2, Rx, and Six3 are involved in formation of
and induction by the optic vesicle (Oliver et al. 1995; Mathers et al.
1997; Porter et al. 1997; Loosli et al. 1999). Lens-forming competence
of the head ectoderm depends on the paired homeodomain protein Pax6
(Fujiwara et al. 1994; Gehring 1996; Furuta and Hogan 1998) and
heterozygous loss of function of PAX6 is responsible for
aniridia in humans (Jordan et al. 1992; Glaser et al. 1994). Necessary
components of lens fiber differentiation and maturation include growth
arrest and crystallin accumulation. The basic leucine zipper (bZIP)
protein L-Maf (Ogino and Yasuda 1998) and Sox high mobility group (HMG)
domain proteins (Kamachi et al. 1998; Nishiguchi et al. 1998) activate
- and 
-crystallin gene expression, respectively. Cell cycle
arrest requires the retinoblastoma protein (Morgenbesser et al. 1994)
and the cyclin-dependent kinase (Cdk) inhibitors
Cdkn1b (p27Kip1) and Cdkn1c
(p57Kip2) (Zhang et al. 1998), which depend on the
homeodomain protein Prox1 for their expression (Wigle et al. 1999). The
cues that induce lens polarity, epithelial proliferation, and fiber
differentiation are differences in growth factor content between the
aqueous and vitreous humor (Hyatt and Beebe 1993; Schulz et al. 1993;
Klok et al. 1998; Potts et al. 1998).
Here we report the cloning of a forkhead transcription factor gene, FoxE3, which is expressed in the lens epithelium. We show that FoxE3 is mutated in a classic mouse model with defect lens development.
| |
Results |
|---|
|
Top
Abstract
Introduction
Results
Discussion
Materials and methods
References
|
|---|
Cloning of FoxE3
In a screen for forkhead genes from a human genomic library (Pierrou
et al. 1994), previously we isolated a partial clone containing a novel
forkhead motif that we named FREAC8 (FOXE3 according
to the latest nomenclature) (Larsson et al. 1995). To locate the
spatial and temporal distribution of expression, we isolated genomic
clones of the mouse homolog to perform in situ hybridization. Following
mouse gene nomenclature recommendations, we call this gene
FoxE3. Sequencing of 7 kb around the forkhead motif of
FoxE3 revealed a single open reading frame of 864 nucleotides, corresponding to a 288-amino-acid protein (Fig. 1).
Comparison with the sequence of human FOXE3 cDNA clones (Å Blixt, M. Ormestad, M. Sparacio, and P. Carlsson, unpubl.) confirmed
that FoxE3 lacks introns and verified the predicted borders of
the coding sequence. The amino acid sequence of FoxE3 has no obvious
similarity to other proteins in the databases, outside the forkhead domain.
|
FoxE3 is expressed in the lens
Whole-mount in situ hybridization of mouse embryos from E8.5 to E10.75 and sections of embryos and adult tissues showed that FoxE3 is expressed in the lens of the developing eye (Fig. 2). Expression is first detected as a small dot on the surface ectoderm around E9.5 (Fig. 2a) and then rapidly increases as the lens placode is formed (Fig. 2b,g). FoxE3 expression becomes confined to the lens vesicle as this structure detaches from the surface ectoderm and initially it is evenly distributed throughout the vesicle (Fig. 2f). In situ hybridization of sections through the developing lens showed that FoxE3 expression is switched off in posterior cells of the lens vesicle as these cells start to differentiate to lens fibers, but remains high in the anterior cells (Fig. 2h). This pattern of FoxE3 expression, limited to the undifferentiated cells covering the anterior surface of the lens (Fig. 2i), is retained throughout embryogenesis and into adulthood. Apart from the lens, FoxE3 expression is seen in only one location during a brief period of development. It first appears on the neural folds in the cephalic region at about the same time as expression in the lateral head ectoderm (Fig. 2a). After closure of the anterior neuropore, expression is found in the most caudal, dorsolateral parts of the diencephalon (Fig. 2b,c,d). The expression level peaks at the 25- to 30-somite stage (E9.5-E10) and then rapidly vanishes. From E11.5, in situ hybridization failed to detect FoxE3 expression at any developmental stage in any tissue, except for in the anterior lens epithelium.
|
FoxE3 is colocalized with dysgenetic lens
Given its early onset and restricted expression pattern, combined
with the well-documented role of forkhead genes in embryogenesis (for
review, see Kaufmann and Knöchel 1996), FoxE3 was an
obvious candidate gene for developmental lens defects. Previously, we have localized the human homolog FOXE3 to 1p32 (Larsson et al. 1995) and although no human lens disorder has been linked to this chromosomal region, the mouse mutation dysgenetic lens
(dyl) (Sanyal and Hawkins 1979) has been mapped to an area of
chromosome 4 syntenic with human 1p32 (Sanyal et al. 1986; Jänne
et al. 1995). dyl arose spontaneously in Balb/c
mice and segregates as an autosomal recessive trait. The most striking
phenotype in this mutant is a persistent connection between the lens
and the corneal epithelium (Fig. 3f), which results from failure of the
lens vesicle to close and separate from the ectoderm (Fig. 3b; Sanyal
and Hawkins 1979). Reduced size, irregular shape, and
disorganized structure with large vacuoles are other characteristics of
the lenses of dyl mice (Fig. 3; Sanyal and Hawkins 1979). Lens
fiber elongation and expression of crystallins are initiated in an
apparently normal way (Brahma and Sanyal 1984, 1987), but the number of
fibers is drastically reduced, resulting in a diminutive, irregular,
and cataractic lens where lens fiber material is sometimes expelled to
the exterior through the persistent ectodermal connection (Fig. 3b). In
wild-type lens, a well-defined epithelial layer is seen on the anterior
surface (Fig. 3e), which is replaced by elongated cells posterior of
the equatorial zone (Fig. 3g). In dyl lens, the epithelial
layer is formed during lens vesicle polarization, but then gradually
disappears and is absent by the time of birth, leaving a cataractic
lens where cell morphology is similar on either side of the lens
equator (Fig. 3h). Apart from the eye defects, dyl mice appear
to be normal.
|
To establish whether FoxE3 is located in the chromosomal
region to which dyl has been mapped, we localized
FoxE3 with fluorescent in situ hybridization (FISH). As shown
in Figure 4, the cytogenetic position of
FoxE3 is 4C7, which is in perfect agreement with the genetic
mapping of dyl to linkage position 49.6 cM of chromosome 4 (Sanyal et al. 1986; Jänne et al. 1995).
|
dyl mutants have mutations in FoxE3
The entire coding region plus 600 bp of flanking sequences of
FoxE3 were determined from a homozygous dyl mouse.
Comparison with the previously determined wild-type sequence revealed
five single nucleotide substitutions, three of which alter the
predicted amino acid sequence of FoxE3. One missense mutation
substitutes a glutamic acid for glutamine at position 253 in the
carboxy-terminal part of the protein and the other two occur close to
each other within the forkhead box. Both the latter are T 
C
transitions that result in phenylalanines being replaced by other amino
acids: Phe-93-Leu and Phe-98-Ser (Fig. 4c). The dyl mutant is
maintained on a Balb/c genetic background, whereas our
wild-type sequence was derived from 129/Sv DNA. To
determine whether the observed mutations are restricted to the
dyl mutant, or reflects differences between the two inbred
strains, we also sequenced FoxE3 from a normal
Balb/c mouse. The two translationally silent mutations and the Gln-253-Glu substitution turned out to be differences between
Balb/c and 129/Sv, whereas the two
mutations in the forkhead box of FoxE3 are specific for the
dyl mutant.
The dyl phenotype cosegregates with FoxE3 mutations
The progeny from sibling matings of dyl/+ mice, obtained from dyl/dyl × Balb/c crossings, were scored for the dyl phenotype by visual inspection of the lens under stereomicroscope (2 weeks postpartum or later) or by microscopic examination of histological sections (embryos or newborn pups). Each individual was also genotyped with regard to the T277C mutation (corresponding to the Phe-93-Leu substitution) in the forkhead box of FoxE3. As shown in Table 1, only FoxE3T277C/FoxE3T277C homozygotes exhibited the lens defects characteristic of dyl mutants.
|
The lens epithelium fails to proliferate in dyl mutants
In situ hybridization of sections through developing eyes from dyl embryos showed that FoxE3 is expressed in an apparently normal way in this mutant during early lens development. At later stages the morphological differences between wild-type and mutant lens make a comparison difficult; hardly anything remains of the lens epithelium in dyl embryos at time points later than E15.5. At E14.5, however, the epithelium has become well defined and the general morphology of dyl and wild-type lenses remain similar enough to allow a direct comparison. At this stage FoxE3 expression is confined to the anterior lens epithelium of both wild-type and mutant (Fig. 5a,b).
|
The lens morphology of dyl mice suggests that the primary defect, leading to a drastic reduction in the number of secondary lens fibers, is failure of the lens epithelium to proliferate. To investigate this, we assayed DNA synthesis in the developing eye of E14.5 and E15.5 embryos by BrdU incorporation. In the anterior epithelium of wild-type lenses from both time points, a high percentage of the cells had gone through S-phase and stained BrdU positive (Fig. 5c,e). In lenses from E14.5 dyl embryos a morphologically distinguishable epithelium is present (for example, see Fig. 5b), but only a few cells had incorporated BrdU (Fig. 5d). At E15.5 no BrdU-positive cells could be detected in the lens (Fig. 5f). Consistent with this, the expression of proliferation markers also differ between dyl and wild-type. The lens epithelium from wild-type embryos contains mRNA for Mki67 (Fig. 5g) and Pcna (Fig. 5i,k), encoding proliferation associated antigens, with the highest expression levels found in the germinative zone next to the neural retina. In dyl mutants, expression of these genes is barely detectable and the residual expression has a more anterior distribution (Fig. 5h,j,l).
dyl lens epithelial cells are eliminated through premature differentiation and apoptosis
In a normal developing lens, a distinct border separates the
dividing cells of the epithelium from the posterior, differentiating cells and this border coincides with the limit for FoxE3
expression. A possible role for FoxE3, compatible with the
lack of epithelial growth in the dyl mutant, could be to
maintain this border by preventing the expression in epithelial cells
of genes involved in growth inhibition and differentiation.
Cdkn1c (= p57KIP2) encodes an inhibitor of
Cdks and is highly expressed in the equatorial zone of the lens, where
cell cycle exit occurs (Fig. 6a; Zhang et al. 1998).
In wild-type E14.5 lens there is no overlap in expression between
FoxE3 and Cdkn1c (Figs. 5a and 6a,c), whereas in the
dyl mutant the expression of Cdkn1c extends
anteriorly into the epithelium (Fig. 6b,d). In addition, the expression
level of Cdkn1c is much lower in dyl lens,
approximately equal to that near the tip of the neural retina (Fig.
6b,d), whereas the wild-type expression is comparable to that in the
periocular chondrogenic mesenchyme (Fig. 6a,c). The homeodomain protein
Prox1 is essential for Cdkn1c expression in lens, as shown by
the absence of Cdkn1c mRNA in lenses of Prox1 null
mice (Wigle et al. 1999). Prox1 is expressed in the entire
lens, but only weakly in the epithelium and with the highest mRNA
levels found in the equatorial zone, coinciding with the site of
Cdkn1c expression (Fig. 6e). In the dyl mutant lens,
the high level of Prox1 expression extends anteriorly into the
epithelium and, like Cdkn1c, overlaps with the expression of
FoxE3 (Fig. 6f).
|
Differentiation is closely linked to cell cycle arrest in lens
development. The Crya1 gene, encoding 1-crystallin, is
expressed at a low level in the epithelial cells, but is induced
transcriptionally to very high levels in the equatorial zone and stays
high in the differentiating lens fibers (Fig. 6g). In the dyl
mutant, epithelial cells express Crya1 at about the same level
as the rest of the lens and no induction is seen in the equatorial zone
(Fig. 6h). Only in the most anterior epithelial cells is the
Crya1 expression lower. E-cadherin is expressed throughout the
lens epithelium and this expression is retained until the cells reach
the equatorial zone and start to differentiate (Fig. 6i). The presence
of E-cadherin-expressing cells on the anterior surface of the lens from
E14.5 dyl mice verify the presence at this stage of an
epithelial layer, despite the lack of proliferation (Fig. 6j). In the
mutant, expression of E-cadherin does not extend as far posteriorly as
in the wild-type lens, which, together with the altered expression
pattern of Crya1, show that the border between differentiated
and undifferentiated cells is moved forward.
Platelet-derived growth factor (PDGF) A is secreted by the iris and the
ciliary body, next to the germinative zone of the lens (Orr-Urtreger
and Lonai 1992; Reneker and Overbeek 1996) and the Pdgfra
gene, encoding the PDGF receptor, is expressed in the lens
epithelium (Fig. 6k,m; Morrison-Graham et al. 1992; Orr-Urtreger and
Lonai 1992). In the dyl mutant, Pdgfra expression is
diminished compared to wild-type and the residual expression is
restricted to the most anterior part of the epithelium (Fig. 6l,n). The
lack of proliferation and the down-regulation of Pdgfra expression suggest that lens epithelial cells in the dyl
mutant may be experiencing a decreased growth factor receptor
signaling. Because many cell types are protected from apoptosis by
growth factor stimulation, we investigated whether the curtailed growth of the lens epithelium in dyl mutants was accompanied by
programmed cell death. No signs of apoptosis could be detected in
wild-type E14.5 lens, whereas the dyl mutant lens had many
apoptotoic cells in the anterior part of the epithelium (Fig. 6o,p).
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Results
Discussion
Materials and methods
References
|
|---|
Of 70 forkhead proteins in the SwissProt database described from
metazoans and Saccharomyces, 67 have an aromatic amino acid in
the position that corresponds to Phe-93 in FoxE3. The other site of
mutation in dyl mice, Phe-98, is even more conserved. Here, 62 of 70 proteins have phenylalanine and 5 additional proteins have other
aromatic amino acids. In the cocrystal structure of the forkhead
protein FoxA3 (HNF3) bound to DNA (Clark et al. 1993), the
aromatic residues corresponding to Phe-93 and Phe-98 of FoxE3
are located in helix 2 of the forkhead helix-turn-helix motif and in
the T' loop connecting helix 2 and helix 3. Together with conserved
aromatic residues from the amino-terminal end of the forkhead domain
and from the carboxy-terminal second wing (W2), these amino acids
generate a rosette-like structure in which a conserved methionine is
surrounded by five aromatic side chains (Fig. 1b; Clark et al. 1993). A
few proteins distantly related to the forkhead main group have
nonaromatic amino acids in either of the two positions corresponding to
Phe-93 and Phe-98. These proteins invariably deviate from consensus in
several other positions of the aromatic rosette and thus appear to rely
on different intramolecular interactions. Deletion of, or mutations in,
the human forkhead gene FOXC1 (previously known as
FREAC3 or FKHL7) cause malformations in the anterior
segment of the eye (Mears et al. 1998; Nishimura et al. 1998). In one
extended pedigree the FOXC1 mutation that cosegregates with
the eye defects is a single nucleotide transition that substitutes a
serine for a phenylalanine in the forkhead domain (Phe-112-Ser)
(Nishimura et al. 1998). Phe-112 of FOXC1 corresponds to one of the
residues in FoxE3 (Phe-98) that is mutated in dyl
mice and in both cases is the phenylalanine replaced by a serine. The
symptoms of patients carrying the Phe-112-Ser mutation in
FOXC1 are as severe as in families where the gene is deleted, which indicates that Phe-112-Ser is a null allele. By analogy, we
predict that Phe-98-Ser is a null allele of FoxE3. In
conclusion, each of the two substitutions in the forkhead domain of
FoxE3 found in dyl mice would be predicted to
obliterate DNA binding. The presence of two such mutations, together
with the colocalization of dyl and FoxE3 in the mouse
genome, cosegregation of the mutations with the dyl phenotype
and defects in dyl mice being confined to the tissue where
FoxE3 is expressed, strongly suggests that mutations in
FoxE3 are responsible for the dyl phenotype.
During normal development, the lens vesicle closes and separates from
the ectoderm, a process that fails in dyl mice (Fig. 3; Sanyal
and Hawkins 1979) and implies FoxE3 as an essential regulator
of this event. In later stages of lens development, FoxE3
appears to be necessary for the growth and survival of the lens
epithelium. In the absence of functional FoxE3 (i.e., in dyl
mutants), initial anteroposterior polarization of the lens vesicle
proceeds normally; by E13.5-14.5 a defined anterior epithelium is
morphologically distinguishable and can also be identified by the
presence of FoxE3 mRNA and E-cadherin. This polarity is thought to depend on differences in growth factor content between the
aqueous and vitreous humor that bathe the anterior and posterior surfaces of the lens, respectively (Hyatt and Beebe 1993; Schulz et al.
1993; Klok et al. 1998; Potts et al. 1998). Lens fiber differentiation
also appears to be independent of FoxE3, as judged by the
expression of crystallins (Brahma and Sanyal 1984, 1987), and primary
fibers fill the lumen of lens vesicles in wild-type and mutant alike.
However, although the cells of a normal lens epithelium enter a phase
of intense cell division, which provides the progenitors of the
secondary lens fibers, the epithelial cells of a dyl mutant
fail to proliferate and eventually disappear. One reason for this
appears to be a changed expression pattern of genes known to promote
cell cycle arrest. The posterior part of the lens epithelium, the
germinative zone, is normally the area in which the most rapid growth
occurs, but in the absence of FoxE3 activity, Cdkn1c and
Prox1 are expressed here. Cdkn1c blocks cell cycle progression
directly by inhibiting Cdks and Prox1 indirectly by activating
Cdkn1c. The cells in what should have been the germinative
zone respond to lack of FoxE3 activity by growth arrest, as illustrated
by loss of expression of Pcna and Mki67 and lack of
BrdU incorporation. Judged by the elevated level of Crya1
expression and the reduced range of E-cadherin expression, the fate of
the most posterior of the epithelial cells instead appears to be
premature differentiation.
Cells in the equatorial zone of the lens, immediately adjacent to the epithelium, show a dramatic reduction in Cdkn1c expression in the dyl mutant. The link between FoxE3 activity in the epithelial cells and Cdkn1c expression in the neighboring cells can only be speculated on, but may involve a paracrine factor produced by the epithelium, the synthesis of which depends on FoxE3.
Although the posterior part of the lens epithelium in dyl
mutants show signs of cell cycle arrest and premature differentiation, the most anterior cells express E-cadherin, but not Cdkn1c or high levels of Crya1. However, the lack of BrdU incorporation show that, in spite of this, no proliferation occurs. Instead, these
cells appear to be eliminated by programmed cell death. Pdgfra, encoding the PDGF receptor, is highly expressed
in the lens epithelium and this expression appears to depend in part on
FoxE3, as seen by the diminished expression level in dyl lens. The ligand, PDGF A, is secreted into the aqueous humor by the ciliary
body, the iris, and the corneal endothelium and stimulates growth of
the lens epithelium (Brewitt and Clark 1988; Potts et al. 1994; Reneker
and Overbeek 1996). That Pdgfra is important for the response
of the epithelium is shown by the developmental lens defects with
reduced number of secondary lens fibers seen in
Patch/Patch mouse embryos, homozygous for a null
mutation in Pdgfra (Morrison-Graham et al. 1992). Therefore,
it seems likely that the reduced Pdgfra expression contributes
to the failure of dyl lens epithelium to proliferate, but the
more severe phenotype of dyl compared to Patch
mutants suggests that other types of growth factor signaling may also
depend on FoxE3. The aqueous humor contains survival factors
for the epithelial cells of the lens (Hyatt and Beebe 1993; Ishizaki et
al. 1993; Renaud et al. 1994; Chow et al. 1995) and the apoptotic fate
of these cells in the dyl mutant implies FoxE3 as a
component in the generation or reception of such signals.
Classic transplantation experiments in chick embryos demonstrated the
importance of the lens epithelium for cornea development (Coulombre and
Coulombre 1964; Genis-Galvez 1966; Genis-Galvez et al. 1967) and recent
work on mouse embryos with null mutations in the forkhead gene
FoxC1 (Mf1) shows that formation of the anterior chamber depends on proper differentiation of the posterior corneal endothelium (Kidson et al. 1999). The cornea in dyl mutants
appears poorly differentiated and lacks the dense, highly structured
appearance of a normal cornea (Fig. 3c-f). The anterior chamber is
missing (Fig. 3c,d) and the posterior surface of the cornea adheres to the lens, presumably due to a poorly developed corneal endothelium (Fig. 3e,f). The nature of the signal produced by the lens epithelium that induces differentiation of the cornea remains unknown, but it is
likely to depend, at least partially, on FoxE3, either
directly or indirectly through maintenance of the lens epithelium.
The eye defects of dyl mice resemble clinical findings in
certain cases of anterior segment dysgenesis, in particular Peters' anomaly (Peters 1906; Stone et al. 1976), which is characterized by
keratolenticular adhesion, central leucoma, microphthalmia, and
adhesion of the iris. Occasionally, Peters' anomaly is caused by
mutations in PAX6 (Hanson et al. 1994), but in the majority of
cases this gene can be excluded and the cause of the defects remains
unknown (Churchill et al. 1998). The human homolog of FoxE3,
FOXE3, located at 1p32 (Larsson et al. 1995), must be
considered a candidate gene for this disorder.
| |
Materials and methods |
|---|
|
Top
Abstract
Introduction
Results
Discussion
Materials and methods
References
|
|---|
Cloning of FoxE3
A genomic 129/Sv 
library (Stratagene) was
screened with a probe from the human FOXE3 gene (Larsson et
al. 1995) and overlapping FoxE3 clones were isolated. A 7-kb
BglII fragment centered around the FoxE3 forkhead box
was subcloned and sequenced on a Beckman CEQ2000 using GPS-1 transposon
insertions (New England Biolabs).
PCR amplification and sequencing
DNA was prepared from Balb/c (Charles River) and dyl/dyl mice (Jackson Laboratory, Maine) and the FoxE3 gene was amplified in two overlapping pieces with the primers (GGGATGGGGCCCAGAGACTGACTC and CGCAGGAAGCTACCGTTGTCGAAC; GCCCTACTCATACATCGCGCTCAT and TGGAGGAGGGCAGGGAAGGCTTAG). PCR products from dyl and wild-type mice were sequenced directly with the same primers used for amplification.
Genotyping of FoxE3T277C
A 270-nucleotide fragment from the forkhead box of FoxE3 was amplified from tail biopsies with the primers GCCCTACTCATACATCGCGCTCAT and CGCAGGAAGCTACCGTTGTCGAAC. Digestion of the product with MnlI generated three fragments from the wild-type allele (150, 114, and 6 nucleotides) and four fragments from the FoxE3T277C allele (114, 82, 68, and 6 nucleotides), which were separated on 3% MetaPhor agarose gels.
Chromosome localization
Fluorescence in situ hybridization of mouse metaphase chromosomes
(Helou et al. 1998) was performed with a 9-kb digoxigenin-labeled probe
containing FoxE3. Hybridization signals were visualized with
FITC-anti digoxigenin and banding patterns by DAPI counterstaining.
Histological sections
Paraffin sections (3 µm) of heads from newborn (3 days) wild-type or dyl mice and cryostat sections (8 µm) from embryos were stained with eosin and hematoxylin.
In situ hybridization and immunohistochemistry
In situ hybridizations of whole mount mouse embryos (Rosen and
Beddington 1994) and cryosections (Henrique et al. 1995) were performed
with digoxigenin-labeled antisense RNA probes. The FoxE3 probe
consists of a 1-kb fragment from the 3' end of the gene. Plasmids
used to generate probes for Pdgfra were kindly provided by Dr.
C. Betsholtz (Göteborg University, Sweden), for Mki67 by
Dr. H. Igarashi (Kumamoto University, Japan), and for Crya1 by
Dr. J. Piatigorsky (National Eye Institute, Bethesda, Maryland). Probes
for Pcna were generated from IMAGE cDNA clone No. 605791. Unique parts of Cdkn1c (pos 200-931 in the sequence with
GenBank accession no. U22399) and Prox1 (pos 132-869 in the
sequence with GenBank accession no. AF061576) were amplified by PCR from genomic mouse DNA and riboprobes were transcribed from promoters appended to the primers. The authenticity of PCR products and cDNA
clones were verified by DNA sequencing. No signals were observed when
control sense probes were used. Radioactive in situ hybridizations of
cryosections were performed as described (Mahlapuu et al. 1998) with
two 33P-labeled antisense oligonucleotides from
FoxE3 (CAGGGAAGGCTTAGCCCAAGCAAGGCTCGGGGACCCAGCGAATTG and
CTCAGGCTGCAAGCCCAACAGGCTGTCCAGGCGGAAGAG). E-cadherin was
detected with a rat monoclonal antibody (kindly provided by Dr. H. Semb) and visualized with a FITC-conjugated secondary antibody (DAKO).
BrdU and TUNEL
Kits from Roche Biochemicals and fluorescence microscopy were used to identify BrdU incorporation and apoptotic cells by the TUNEL assay in cryosections. In vivo BrdU labeling of embryos was achieved by intraperitoneal injection of 0.1 µmole of BrdU/g body weight, 4 hr before the pregnant females were sacrificed.
| |
Acknowledgments |
|---|
This work was supported by the Swedish Cancer Foundation (grant no. 3517-B98-05XAC), Magnus Bergvall's Foundation, Assar Gabrielsson's Foundation, and The Medical Research Fund of Tampere University Hospital. The authors are grateful to Khalil Helou and Göran Levan for help with FISH and permission to use their fluorescence microscope; to Christer Betsholtz, Joram Piatigorsky, and Hideya Igarashi for plasmid clones; to Henrik Semb (Göteborg University, Sweden) for the E-cadherin antibody; to Malin Hulander, Linda Karlsson, and Stefan Norlin for advice on in situ hybridizations; to Mattias Ormestad, Mariavittoria Sparacio, and Ulla Jukarainen for technical assistance and to an anonymous reviewer for valuable suggestions.
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
| |
Note |
|---|
The GenBank accession no. for the FoxE3 locus (7kb) is AF142647.
| |
Footnotes |
|---|
Received October 5, 1999; revised version accepted November 26, 1999.
3 Corresponding author.
E-MAIL peter.carlsson{at}molbio.gu.se; FAX +46 31 7733801.
| |
References |
|---|
|
Top
Abstract
Introduction
Results
Discussion
Materials and methods
References
|
|---|
A new gene in the mouse.
Invest. Ophthalmol. Vis. Sci.
18:
642-645
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. G. Matteson, J. Desai, R. Korstanje, G. Lazar, T. E. Borsuk, J. Rollins, S. Kadambi, J. Joseph, T. Rahman, J. Wink, et al. The orphan G protein-coupled receptor, Gpr161, encodes the vacuolated lens locus and controls neurulation and lens development PNAS, February 12, 2008; 105(6): 2088 - 2093. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Ogino, M. Fisher, and R. M. Grainger Convergence of a head-field selector Otx2 and Notch signaling: a mechanism for lens specification Development, January 15, 2008; 135(2): 249 - 258. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Astorga and P. Carlsson Hedgehog induction of murine vasculogenesis is mediated by Foxf1 and Bmp4 Development, October 15, 2007; 134(20): 3753 - 3761. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Zarbalis, J. A. Siegenthaler, Y. Choe, S. R. May, A. S. Peterson, and S. J. Pleasure Cortical dysplasia and skull defects in mice with a Foxc1 allele reveal the role of meningeal differentiation in regulating cortical development PNAS, August 28, 2007; 104(35): 14002 - 14007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Medina-Martinez and M. Jamrich Foxe view of lens development and disease Development, April 15, 2007; 134(8): 1455 - 1463. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Wiggs Genetic Etiologies of Glaucoma Arch Ophthalmol, January 1, 2007; 125(1): 30 - 37. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Asai-Coakwell, C. Backhouse, R. J. Casey, P. J. Gage, and O. J. Lehmann Reduced Human and Murine Corneal Thickness in an Axenfeld-Rieger Syndrome Subtype Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4905 - 4909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
