Genes and Development

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Published online before print October 16, 2003, 10.1101/gad.1140503
GENES & DEVELOPMENT 17:2636-2641, 2003
©2003 by Cold Spring Harbor Laboratory Press; ISSN 0890-9369/ $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Research Data
Right arrow All Versions of this Article:
1140503v1
17/21/2636    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, H.
Right arrow Articles by Greenberg, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, H.
Right arrow Articles by Greenberg, J. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

RESEARCH COMMUNICATION

Ceramides modulate programmed cell death in plants

Hua Liang, Nan Yao, Jong Tae Song, Song Luo, Hua Lu and Jean T. Greenberg1

Department of Molecular Genetics and Cell Biology, The University of Chicago, Chicago, Illinois 60637, USA


    Abstract
 Top
 Abstract
 Results and Discussion
 Materials and methods
 Acknowledgments
 References
 
The balance between the bioactive sphingolipid ceramide and its phosphorylated derivative has been proposed to modulate the amount of programmed cell death (PCD) in eukaryotes. We characterized the first ceramide kinase (CERK) mutant in any organism. The Arabidopsis CERK mutant, called accelerated cell death 5, accumulates CERK substrates and shows enhanced disease symptoms during pathogen attack and apoptotic-like cell death dependent on defense signaling late in development. ACD5 protein shows high specificity for ceramides in vitro. Strikingly, C2 ceramide induces, whereas its phosphorylated derivative partially blocks, plant PCD, supporting a role for ceramide phosphorylation in modulating cell death in plants.

[Keywords: Apoptosis; sphingolipids; Arabidopsis; ceramide kinase]

Received August 5, 2003; revised version accepted September 8, 2003.


Ceramides and their related sphingolipid derivatives are bioactive lipids that play important roles as second messengers in animals (Hannun and Obeid 2002Go). This family of signal molecules can profoundly affect cell fate, eliciting apoptosis and/or altering differentiation or cell-cycle events (Hannun and Obeid 2002Go). A ceramide kinase (CERK) from humans was recently identified and shown to act on a number of ceramide substrates with much higher activity than the related sphingosine substrate (Sugiura et al. 2002Go). Although phosphorylated ceramide has been proposed to have novel functions promoting vesicle fusion (Bajjalieh et al. 1989Go; Hinkovska-Galcheva et al. 1998Go) and stimulating DNA synthesis (Gomez-Munoz et al. 1995Go, 1997Go), it has also been proposed to play a role in dampening signals for apoptosis in animals (Sugiura et al. 2002Go). Homologs of the human CERK are present in a number of higher eukaryotes, including plants, but yeast lack a clear homolog (Sugiura et al. 2002Go). This suggests a role for CERK in processes important for a multicellular lifestyle.

The role of sphingolipids in controlling plant cell fate is not well characterized. The fungal toxin fumonisin induces plant programmed cell death (PCD) through a process thought to involve disruption of sphingolipid metabolism, although the mechanism by which it acts in plants is still unclear (Asai et al. 2000Go). The ectopic PCD phenotype of Arabidopsis mutants lacking a sphingosine transfer protein also provides a hint that sphingolipids have a role in plant cell death control (Brodersen et al. 2002Go). However, a direct demonstration of the involvement of ceramides or other sphingolipids in plant PCD is still lacking.

We report here the first characterization of a CERK mutant in any organism, called accelerated cell death 5 (acd5). We previously showed that Arabidopsis acd5 mutant plants initially develop normally, but show excessive cell death upon infection with the bacterial pathogen Pseudomonas syringae. Furthermore, acd5 mutant plants late in development show spontaneous cell death largely dependent on the stress and defense signaling pathways controlled by the hormone ethylene and the phenolic salicylic acid, respectively (Greenberg et al. 2000Go). acd5 plants have a number of the characteristics of wild-type plants infected with P. syringae (Greenberg et al. 2000Go). This includes the accumulation of a number of defense-related compounds and markers (Greenberg et al. 2000Go). However, acd5 plants support modestly increased growth of P. syringae, suggesting a role for ACD5 in controlling disease susceptibility (Greenberg et al. 2000Go).

The Arabidopsis acd5 mutant hyperaccumulates the lipid substrates for recombinant ACD5 CERK and shows spontaneous cell death with some apoptotic features late in development. Furthermore, ceramide is sufficient to induce cell death in wild-type and acd5 protoplasts, with effects on wild-type protoplasts that are weaker than those seen on acd5. Ceramide-1-phosphate was able to partially abrogate the cell death-inducing effects of ceramide. Our study provides strong evidence that the balance between ceramide and its phosphorylated derivative modulates the amount of PCD in plants. Furthermore, these data suggest a conserved mechanism for regulating PCD in plants and animals. The existence of a conserved PCD regulatory pathway will help to clarify the identity and evolutionary origin of the basal eukaryotic cell death machinery.


    Results and Discussion
 Top
 Abstract
 Results and Discussion
 Materials and methods
 Acknowledgments
 References
 
We used map-based cloning to isolate the ACD5 gene (see Materials and Methods) and found it to encode a 608-amino acid-long protein with 31% identity and 43% similarity, respectively, to the biochemically characterized human CERK enzyme (Sugiura et al. 2002Go). This similarity occurred throughout most of the ACD5 region spanning amino acids 96-607. The acd5 mutant harbored a missense mutation that in the predicted protein converted the glycine at amino acid 412 to arginine due to a G-to-A mutation in the first position of the codon. (Fig. 1A). This glycine is conserved in most CERK homologs found in the database (data not shown). The acd5 cell death phenotype was complemented with a genomic clone of ACD5 (Fig. 1B).



View larger version (97K):
[in this window]
[in a new window]
 
Figure 1. Identification and complementation of the acd5 mutation. (A) Features of the wild-type and mutant ACD5 protein are shown. Numbers indicate the positions of amino acids. The region between amino acids 164 and 366 shows similarity to the diacylglycerol kinase (DAGK) family (E = 0.0073). Arrow indicates the region of similarity in ACD5 to human CERK. Asterisk indicates the position of the mutation in acd5. (B) Complementation of acd5 with a genomic clone of the ACD5 gene. Note the lack of cell death regions in the complemented plant.

 

To determine whether ACD5 possessed CERK activity, we produced and purified recombinant enzyme and performed activity assays on ceramides and related substrates. ACD5 showed highest activity on synthetic C6 and C8 ceramides and 10- to 20-fold less activity on natural ceramides (a mixture of ceramides from bovine brain) and the synthetic substrate C2 ceramide, respectively (Fig. 2A,B). ACD5 showed only weak activity on diacyl glycerol and sphingosine. As expected, the recombinant mutant enzyme had very little activity (Fig. 2A,B). Dihydroceramides were poorer substrates for ACD5 than the corresponding unsaturated ceramides (Fig. 2B). The ACD5 CERK showed typical Michaelis-Menton kinetics with C8 ceramide and had a Km of 24.4 µM (Fig. 2C). Like the human CERK (Sugiura et al. 2002Go), ACD5 CERK activity was stimulated by Ca2+ (Fig. 2D). ACD5 CERK had an optimum pH of 8.2 and was most active at 30°C (data not shown). Importantly, acd5 crude extracts had 10-fold less CERK activity than wild-type crude extracts in phosphorylating C8 ceramide (Fig. 2E). Furthermore, ceramide-enriched lipid extracts from acd5 were phosphorylated by recombinant ACD5 three- to eightfold more than the ceramide-enriched lipid extracts from wild-type plants (Fig. 2F). This indicates that ACD5 CERK substrates accumulated in acd5 plants to a greater extent than in wild-type plants. The phosphorylated ACD5 CERK substrates comigrated with the phosphorylated synthetic C6 (and to a lesser degree C8) ceramide marker on thin layer chromatographs (TLCs; Fig. 2F).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. CERK activity of ACD5. (A) Autoradiographs of TLC plates detecting 32P incorporation from [{gamma}-32P]ATP (3000 Ci/mmole) into lipid substrates. (rACD5) Recombinant ACD5; (DAGK) diacylglycerol kinase. (B) Quantitative analysis of relative ACD5 CERK activity. Standard deviations are indicated (n = 3). ACD5 activity was 344 and 36.1 fmole/min/pmole of enzyme, using C8 and natural ceramide (cer), respectively. (C) Kinetic analysis of recombinant ACD5. Standard deviations are indicated (n = 3). (D) Effect of various cations (100 mM) on recombinant ACD5 enzyme activity. (E) Conversion of C8 ceramide to C8 ceramide-1-phospate by E. coli DAGK and crude extracts from 33-day-old plants; 2.5-fold more acd5 protein extract than wild-type (ACD5+) extract was used in the assay. (F) Accumulation of ACD5 CERK substrates in acd5 and wild-type lipid extracts. Recombinant ACD5 or vector control protein (-) was used to phosphorylate ceramide-enriched acd5 and wild-type lipid extracts, and the phosphorylated products were run on TLC. Darker bands in acd5 lanes indicate that more CERK substrate was present in the acd5 lipid extracts than in the wild-type lipid extracts; 1.5-fold more lipids were loaded on the TLC plate from the 25-day-old vs. 35-day-old material.

 

Because acd5 accumulates CERK substrates and ceramides are known to induce apoptosis in animals, we examined acd5 mutant cells for apoptotic features. acd5 cells at the initiation of cell death (Fig. 3B) showed regions of condensed chromatin in their nuclei (Fig. 3D). These regions had a large number of DNA strand breaks generated by endonucleolytic cleavage as evidenced by the high degree of terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeled (TUNEL) staining (Fig. 3F). acd5 showed significantly more TUNEL staining than wild type at both 16 and 26 d (Fig. 3G, P = 0.001, Student's t-test). Other organelles, including mitochondria, in these TUNEL-staining cells did not show any obvious changes in their morphology or integrity (Supplementary Fig. 1), although cells at more advanced stages of cell death showed highly condensed chromatin and abundant DNA fragments typical of apoptotic cells (data not shown).



View larger version (73K):
[in this window]
[in a new window]
 
Figure 3. Apoptosis-like cell death in acd5 mutant plants. (A,B) Light micrograph of cross-sections of 18-day-old wild-type (A) and acd5 (B) leaves stained with toluidine blue. Arrows indicate dying cells. (C) Transmission electron micrograph (TEM) of one of the wild-type mesophyll cells from A. (D) TEM of one of the acd5 mesophyll cells adjacent to the dying cell by the left arrow in B. Arrowhead and arrow indicate an aggregate of condensed chromatin and a morphologically intact mitochondrion, respectively. (E,F) EM-TUNEL analysis of the localization of DNA strand breaks in the mesophyll cell nuclei of wild-type (E) and acd5 (F) leaf segments from the tissue shown in A and B. (F) Note that immunogold-labeled DNA fragments were abundantly localized in the condensed heterochromatin portion of the acd5 mesophyll cell nucleus. Abbreviations used in C-F were as follows: (N) nucleus; (Ch) chloroplast; (V) vacuole; (Hc) heterochromatin; (Eu) euchromatin. (G) Statistical analysis of the density of endonucleolytic DNA strand breaks. Bars: A,B, 50 µm; C,D, 1 µm; E,F, 200 nm.

 

To further establish that ceramides are sufficient to induce cell death in plants, we treated wild-type protoplasts with C2 ceramide and found that it induced nuclear fragmentation characteristic of apoptotic dying cells (Fig. 4A). We also treated wild-type and acd5 protoplasts with different doses of the soluble C2 ceramide or its biosynthetic precursor, C2 dihydroceramide. C2 ceramide was more potent than the dihydroceramide at eliciting cell death of both wild-type and acd5 protoplasts at all concentrations tested (Fig. 4B; P < 0.02), similar to what has been reported in animal cells (for review, see Hannun and Obeid 2002Go). Furthermore, acd5 protoplasts were significantly more sensitive to C2 ceramide than wild-type protoplasts at all concentrations tested (Fig. 4B; P < 0.02). Thus, ceramide is sufficient to induce cell death in Arabidopsis. Interestingly, the presence of C2 ceramide-1-phosphate partially blocked cell death induction by C2 ceramide (Fig. 4C), suggesting that differently modified ceramides have distinct biological activities.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 4. Cell death-modulating activities of ceramides. (A) Nuclear morphology of wild-type protoplasts after control or C2 ceramide treatments. Protoplasts were stained for nuclei using Hoechst33342 16 h after treatment with 30 µM C2 ceramide. Protoplasts showed 32% viability. Bar, 10 µm. The percentage of protoplasts of each genotype with the morphologies shown is indicated below each picture. (B) Ceramide-induced cell death in wild-type and acd5 protoplasts. Protoplasts were treated with C2 ceramide (open symbols) or C2 dihydroceramide (closed symbols) for 10 h. (Circles) Wild-type protoplasts; (triangles) acd5 protoplasts. Standard deviations are shown (n = 3). Some symbols obscure the error bars. (C) Cell death-blocking effects of C2 ceramide-1-phosphate (C2-1P). Protoplasts were left untreated or were treated with 0.2% ethanol (solvent in which ceramides were dissolved), 30 µM C2 ceramide, 30 µM C2 ceramide + 10 µM C2 ceramide-1-phosphate, or 10 µM C2 ceramide-1-phosphate for 18 h. Standard deviations are shown (n = 3). Letters indicate that values are different using Student's t-test (P < 0.04).

 

As acd5 mutants have increased disease symptoms upon P. syringae infection (Greenberg et al. 2000Go), we examined whether steady-state ACD5 mRNA levels were modulated during pathogenesis. We inoculated wild-type plants with disease-causing virulent P. syringae and a congenic strain to which the plants were resistant due to the presence of the avrRpm1 gene in the bacteria (rendering the strain avirulent). We found only modest induction of ACD5 mRNA in response to P. syringae/avrRpm1 and about fivefold induction of ACD5 mRNA in plants infected with virulent P. syringae (Fig. 5). The relatively high induction of ACD5 mRNA with virulent bacteria correlates well with the observation that more cell death is induced in acd5 plants with virulent versus avirulent bacteria (Greenberg et al. 2000Go). It was recently shown that virulent P. syringae possess at least one protein that, when injected into host cells, suppresses PCD and promotes virulence (Abramovitch et al. 2003Go). The induction of ACD5 mRNA could be one way that such suppression is achieved. In avirulent bacteria, such a suppressive mechanism may be overridden by the PCD-promoting activity of other injected proteins such as AvrRpm1. In potato, the serine palmitoyltransferase gene, encoding the first committed step in the de novo sphingolipid biosynthesis pathway, was induced after infection with Phytophthora infestans (Birch et al. 1999Go). This indicates that multiple steps in the sphingolipid pathway may be activated by infection.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. ACD5 mRNA induction during P. syringae infection. Relative levels of ACD5 mRNA transcript averaged from two experiments are shown. Bars indicate standard deviations.

 

We propose that the balance between ceramides and their phosphorylated derivatives is important for modulating cell death in plants in a manner dependent on the defense and stress signals salicylic acid and ethylene (Greenberg et al. 2000Go). Our data support the view that phosphorylation of ceramides by the ACD5 CERK directly dampens the proapoptotic effects of unphosphorylated ceramides. A similar scenario likely exists in animals as well (Sugiura et al. 2002Go); the related sphingosine-1-phosphate has been shown to suppress PCD in animals (Cuvillier et al. 1996Go). Do plants and animals have a similar mechanism for the execution of ceramide-mediated PCD? In animals, ceramide activates PCD in a process in which mitochondria play a prominent role (Birbes et al. 2002Go). Interestingly, ceramide-induced PCD in plant protoplasts requires the mitochondria to undergo a permeability transition much like that described in animals (N. Yao and J.T. Greenberg, unpubl.). This suggests that there are common elements in the regulation and execution of ceramide-mediated PCD in plants and animals. Determination of the plant targets of the different bioactive sphingolipids should provide tools for insightful comparative studies of their mechanisms of action in both plants and animals.


    Materials and methods
 Top
 Abstract
 Results and Discussion
 Materials and methods
 Acknowledgments
 References
 

Materials

Natural ceramide and sphingosine were purchased from Sigma. C2, C16 ceramides, and C2 dihydroceramide were from Matreya. C2 ceramide-1-phosphate was from Avanti Polar Lipids. Other ceramides were from BIOMOL Research Laboratory. Recombinant Escherichia coli diacylglycerol kinase was from Calbiochem. All other lipids were purchased from Avanti Polar Lipids. [{gamma}-32P]ATP (3000 Ci/mmole) was purchased from Amersham Biosciences. Iatrobeads (6RS 8060) were from Iatron Laboratory. TLC plates (Baker Si250) were from Mallickrodt Baker. Wild-type and acd5 mutant Arabidopsis thaliana plants (ecotype Columbia) were grown in 16-hour-day conditions, as described (Greenberg et al. 2000Go).


Map-based cloning of ACD5

Fine mapping of the acd5 mutation was conducted in both acd5 x Ler F2 and acd5 x Cvi F2 populations using standard approaches. Approximately 3000 F2 plants showing the acd5 phenotype (2000 from the cross to Ler and 1000 from the cross to Cvi) were analyzed. Markers were made based on the Cereon Arabidopsis polymorphism database (http://www.arabidopsis.org/cereon) and random sequencing of the Cvi genome in the region of ACD5. Markers are available upon request.

The acd5 mutation mapped to a 81-kb region between nucleotides 20379600 and 20461201 on chromosome 5. BAC clone MWD22 (Ohio State Stock Center) that covers most of this region was subcloned into binary vector pAOV-35 [a vector derived from pAOV (Mylne and Botella 1998Go) from which the CaMV 35S promoter was removed]. Nine clones with 10-15-kb inserts that overlapped for at least 5 kb were transformed into acd5npr1 plants (which have better fertility than acd5 alone; Greenberg et al. 2000Go) by the Agrobacterium-mediated floral dip method (Bechtold and Pelletier 1998Go) for complementation tests. T1 seeds were selected by spraying the herbicide basta. Clone 1H3 with three predicted open reading frames (ORFs encoded by the genes At5g51280, At5g51290, At5g51300) not contained in any overlapping noncomplementing clones rescued the cell death phenotype in acd5 npr1. Only ORF At5g51290 harbored a mutation in acd5 genomic DNA.

A 7-kb NcoI fragment from 1H3 encompassing the entire genomic gene At5g51290 was cloned into the pGR111 [a modified version of the pGreen binary vector (Hellens et al. 2000Go) and a gift from Dr. Daphne Preuss, University of Chicago, Chicago, IL]. Fifteen of seventeen transformed acd5 plants were complemented by this pACD5 construct. An ACD5 RNAi construct transformed into wild-type plants also recapitulated the acd5 mutant phenotype (data not shown).


Isolation of ACD5 cDNA

Reverse transcriptase PCR (RT-PCR) was performed on wild-type and acd5 poly(A)-RNA using Superscript II (Invitrogen) and Pfu DNA polymerase (Stratagene). Products were cloned into the pET14b E. coli expression vector (Novagen) in frame with a 6x His-tag at the C-terminal end.

The GenBank accession number for the ACD5 cDNA is AY362552 [GenBank] .


CERK activity assay

CERK activity was measured as described (Bajjalieh and Batchelor 2000Go) except that plant crude extract or 2 pmoles (142 ng) recombinant protein purified by NTA nickel agarose column (in 192 mM imidazole, 50 mM NaPO4 at pH 8.0, and 300 mM NaCl) was used and 10 µM ATP was included in each reaction. Reactions were analyzed by TLC developed with chloroform:methanol:acetic acid (65:15:10), or counted with a scintillation counter (QC 4000, Bioscan) for kinetic studies.

To prepare crude extracts, 0.8 g of tissue was frozen in liquid N2, homogenized, and placed in 1 mL extraction buffer (20 mM MOPS at pH 7.2, 2 mM EGTA, 1 mM DTT, 10% glycerol) to which 1 µL of plant protease inhibitor cocktail P9599 (Sigma) was added. The extract was centrifuged for 10 min at 14,000 g, and supernatant was assayed for CERK activity. The diacylglycerol kinase assay was the same as above except for the following different components in the reaction mixture: 888 µM diacylglycerol, 2 mM EDTA, and 5 mM MgCl2.


Lipid profile analysis

Plant sphingolipids were extracted according to Fujiwaki et al. (1999Go) using one gram of tissue. Iatrabeads (Iatron Laboratory) were used to purify crude sphingolipids, following the method of Vance and Sweely (1967Go).


Protoplast preparation and treatment

Protoplasts were prepared using 14-18-day-old plants as described (Asai et al. 2000Go) except that 1.2% cellulase Onozuka R-10 from Trichoderma viride and 0.3% macerozyme R-10 from Rhizopus sp. lyophil. (SERVA Electrophoresis) were used. C2 ceramide, C2 dihydroceramide, and C2 ceramide-1-phosphate were dissolved in ethanol.

The viability of protoplasts after treatments was determined by fluorescein diacetate (FDA) staining (500 ng/mL) using a Hemacytometer (Hausser Scientific). At least 300 cells per treatment were counted. Trials were performed in triplicate.


Ultrastructural analysis and EM-TUNEL assay

Leaf segments were fixed as described (Yao et al. 2001Go) and embedded in Epon (Electron Microscopy Sciences). The EM-TUNEL procedure using an ApopTag Plus Fluorescein in situ Apoptosis Detection Kit (Intergen) and the statistical analysis were done as described (Yao et al. 2001Go). Sheep anti-digoxigenin antibody conjugated to 10 nm colloidal gold was from Electron Microscopy Sciences. A Philips CM-120 transmission electron microscope was used at an accelerating voltage of 120 kV.


RNA blot analysis

RNA blot analysis was performed as described (Rate et al. 1999Go). A portion of the ACD5 cDNA (nt 687-1659) was amplified by PCR using the primer pairs pr24-1F-2 (CTTGCAATTTGCACGACATAG) and pr24-3R (GCAGACGTGCCAGAGTTGGA) and used as a probe. EF1{alpha} was used as a loading control.


Plant infections

Inoculations at OD600 = 0.01 of strains DG3 (virulent), DG34 (carrying avrRpm1) or 10 mM MgSO4 (mock control) into 19-21-day-old plants was done as described (Rate et al. 1999Go). DG3 and DG34 are derived from P. syringae pv maculicola strain ES4326 (Guttman and Greenberg 2001Go).


    Acknowledgments
 Top
 Abstract
 Results and Discussion
 Materials and methods
 Acknowledgments
 References
 
We thank Jonathan Fitzgerald, John Celenza, and Glyn Dawson for valuable discussions and advice. We also thank Kasturi Hardura, Daniel Lynch, and Cameron Sullards for comments on the manuscript. This work was supported by a grant from the NIH to J.T.G. We thank the Ohio State Stock Center for BAC clones and the RIKEN Center for cDNA clones.

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 USC section 1734 solely to indicate this fact.


    Footnotes
 
Supplemental material is available at http://www.genesdev.org.

Article published online ahead of print. Article and publication date are at http://www.genesdev.org/cgi/doi/10.1101/gad.1140503.

1 Corresponding author.
E-MAIL jgreenbe{at}midway.uchicago.edu; FAX (773) 702-9270.
Back


    References
 Top
 Abstract
 Results and Discussion
 Materials and methods
 Acknowledgments
 References
 
Abramovitch, R., Kim, Y., Chen, S., Dickman, M., and Martin, G. 2003. Pseudomonas type III effector AvrPtoB induces plant disease susceptibility by inhibition of host programmed cell death. EMBO J. 22: 60-69.[CrossRef][Medline]

Asai, T., Stone, J.M., Heard, J.E., Kovtun, Y., Yorgey, P., Sheen, J., and Ausubel, F.M. 2000. Fumonisin B1-induced cell death in Arabidopsis protoplasts requires jasmonate-, ethylene-, and salicylate-dependent signaling pathways. Plant Cell 12: 1823-1835.[Abstract/Free Full Text]

Bajjalieh, S. and Batchelor, R. 2000. Ceramide kinase. Methods Enzymol. 311: 207-215.[Medline]

Bajjalieh, S.M., Martin, T.F., and Floor, E. 1989. Synaptic vesicle ceramide kinase. A calcium-stimulated lipid kinase that co-purifies with brain synaptic vesicles. J. Biol. Chem. 264: 14354-14360.[Abstract/Free Full Text]

Bechtold, N. and Pelletier, G. 1998. In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol. Biol. 82: 259-266.[Medline]

Birbes, H., El Bawab, S., Obeid, L.M., and Hannun, Y.A. 2002. Mitochondria and ceramide: Intertwined roles in regulation of apoptosis. Adv. Enzyme Regul. 42: 113-129.[CrossRef][Medline]

Birch, P.R.J., Avrova, A.O., Duncan, J.M., Lyon, G.D., and Toth, R.L. 1999. Isolation of potato genes that are induced during an early stage of the hypersensitive response to Phytophthora infestans. Mol. Plant Microbe Interact. 12: 356-361.

Brodersen, P., Petersen, M., Pike, H.M., Olszak, B., Skov, S., Odum, N., Jorgensen, L.B., Brown, R.E., and Mundy, J. 2002. Knockout of Arabidopsis accelerated-cell-death11 encoding a sphingosine transfer protein causes activation of programmed cell death and defense. Genes & Dev. 16: 490-502.[Abstract/Free Full Text]

Cuvillier, O., Pirianov, G., Kleuser, B., Vanek, P.G., Coso, O.A., Gutkind, J.S., and Spiegel, S. 1996. Suppression of ceramide-mediated programmed cell death by sphingosine-1-phosphate. Nature 381: 800-803.[CrossRef][Medline]

Fujiwaki, T., Yamaguchi, S., Sukegawa, K., and Taketomi, T. 1999. Application of delayed extraction matrix-assisted laser desorption ionization time-of-flight mass spectrometry for analysis of sphingolipids in tissues from sphingolipidosis patients. J. Chromatogr. B 731: 45-52.[CrossRef]

Gomez-Munoz, A., Duffy, P.A., Martin, A., O'Brien, L., Byun, H.S., Bittman, R., and Brindley, D.N. 1995. Short-chain ceramide-1-phosphates are novel stimulators of DNA synthesis and cell division: Antagonism by cell-permeable ceramides. Mol. Pharmacol. 47: 833-839.[Abstract]

Gomez-Munoz, A., Frago, L.M., Alvarez, L., and Varela-Nieto, I. 1997. Stimulation of DNA synthesis by natural ceramide 1-phosphate. Biochem. J. 325: 435-440.

Greenberg, J.T., Silverman, F.P., and Liang, H. 2000. Uncoupling salicylic acid-dependent cell death and defense-related responses from disease resistance in the Arabidopsis mutant acd5. Genetics 156: 341-350.[Abstract/Free Full Text]

Guttman, D.S. and Greenberg, J.T. 2001. Functional analysis of type III effectors AvrRpt2 and AvrRpm1 of P. syringae using a single copy genomic integration system. Mol. Plant-Microbe Interact. 14: 145-155.[Medline]

Hannun, Y.A. and Obeid, L.M. 2002. The ceramide-centric universe of lipid-mediating cell regulation: Stress encounters of the lipid kind. J. Biol. Chem. 277: 25847-25850.[Free Full Text]

Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S., and Mullineaux, P.M. 2000. pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42: 819-832.[CrossRef][Medline]

Hinkovska-Galcheva, V.T., Boxer, L.A., Mansfield, P.J., Harsh, D., Blackwood, A., and Shayman, J.A. 1998. The formation of ceramide-1-phosphate during neutrophil phagocytosis and its role in liposomefusion. J. Biol. Chem. 273: 33203-33209.[Abstract/Free Full Text]

Mylne, J. and Botella, J.R. 1998. Binary vectors for sense and antisense expression of Arabidopsis ESTs. Plant Mol. Biol. Rep. 16: 257-262.[CrossRef]

Rate, D.N., Cuenca, J.V., Bowman, G.R., Guttman, D.S., and Greenberg, J.T. 1999. The gain-of-function Arabidopsis acd6 mutant reveals novel regulation and function of the salicylic acid signaling pathway in controlling cell death, defenses, and cell growth. Plant Cell 11: 1695-1708.[Abstract/Free Full Text]

Sugiura, M., Kono, K., Liu, H., Shimizugawa, T., Minekura, H., Spiegel, S., and Kohama, T. 2002. Ceramide kinase, a novel lipid kinase. J. Biol. Chem. 277: 23294-23300.[Abstract/Free Full Text]

Vance, D.E. and Sweeley, C.C. 1967. Quantitative determination of the neutral glycosyl ceramides in human blood. J. Lipid Res. 8: 621-630.[Abstract]

Yao, N., Tada, Y., Park, P., Nakayashiki, H., Tosa, Y., and Mayama, S. 2001. Novel evidence for apoptotic cell response and differential signals in chromatin condensation and DNA cleavage in victorin-treated oats. Plant J. 28: 13-26.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Plant CellHome page
M. Chen, J. E. Markham, C. R. Dietrich, J. G. Jaworski, and E. B. Cahoon
Sphingolipid Long-Chain Base Hydroxylation Is Important for Growth and Regulation of Sphingolipid Content and Composition in Arabidopsis
PLANT CELL, July 1, 2008; 20(7): 1862 - 1878.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. Zhang, R. A. Barthelson, G. M. Lambert, and D. W. Galbraith
Global Characterization of Cell-Specific Gene Expression through Fluorescence-Activated Sorting of Nuclei
Plant Physiology, May 1, 2008; 147(1): 30 - 40.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. Raffaele, F. Vailleau, A. Leger, J. Joubes, O. Miersch, C. Huard, E. Blee, S. Mongrand, F. Domergue, and D. Roby
A MYB Transcription Factor Regulates Very-Long-Chain Fatty Acid Biosynthesis for Activation of the Hypersensitive Cell Death Response in Arabidopsis
PLANT CELL, March 1, 2008; 20(3): 752 - 767.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. Teng, H. Dong, L. Shi, Y. Deng, J. Mu, J. Zhang, X. Yang, and J. Zuo
Serine Palmitoyltransferase, a Key Enzyme for de Novo Synthesis of Sphingolipids, Is Essential for Male Gametophyte Development in Arabidopsis
Plant Physiology, March 1, 2008; 146(3): 1322 - 1332.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Tsegaye, C. G. Richardson, J. E. Bravo, B. J. Mulcahy, D. V. Lynch, J. E. Markham, J. G. Jaworski, M. Chen, E. B. Cahoon, and T. M. Dunn
Arabidopsis Mutants Lacking Long Chain Base Phosphate Lyase Are Fumonisin-sensitive and Accumulate Trihydroxy-18:1 Long Chain Base Phosphate
J. Biol. Chem., September 21, 2007; 282(38): 28195 - 28206.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Spiegel and S. Milstien
Functions of the Multifaceted Family of Sphingosine Kinases and Some Close Relatives
J. Biol. Chem., January 26, 2007; 282(4): 2125 - 2129.
[Full Text] [PDF]


Home page
Plant CellHome page
M. Chen, G. Han, C. R. Dietrich, T. M. Dunn, and E. B. Cahoon
The Essential Nature of Sphingolipids in Plants as Revealed by the Functional Identification and Characterization of the Arabidopsis LCB1 Subunit of Serine Palmitoyltransferase
PLANT CELL, December 1, 2006; 18(12): 3576 - 3593.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. E. Markham, J. Li, E. B. Cahoon, and J. G. Jaworski
Separation and Identification of Major Plant Sphingolipid Classes from Leaves
J. Biol. Chem., August 11, 2006; 281(32): 22684 - 22694.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Stein, J. Dittgen, C. Sanchez-Rodriguez, B.-H. Hou, A. Molina, P. Schulze-Lefert, V. Lipka, and S. Somerville
Arabidopsis PEN3/PDR8, an ATP Binding Cassette Transporter, Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration
PLANT CELL, March 1, 2006; 18(3): 731 - 746.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
N. Yao and J. T. Greenberg
Arabidopsis ACCELERATED CELL DEATH2 Modulates Programmed Cell Death
PLANT CELL, February 1, 2006; 18(2): 397 - 411.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
N. F. Lamour and C. E. Chalfant
Ceramide-1-phosphate: The "missing" link in eicosanoid biosynthesis and inflammation
Mol. Interv., December 1, 2005; 5(6): 358 - 367.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
N. A. Eckardt
Ins and Outs of Programmed Cell Death and Toxin Action
PLANT CELL, November 1, 2005; 17(11): 2849 - 2851.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. E. Chalfant and S. Spiegel
Sphingosine 1-phosphate and ceramide 1-phosphate: expanding roles in cell signaling
J. Cell Sci., October 15, 2005; 118(20): 4605 - 4612.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
H. Imai and H. Nishiura
Phosphorylation of Sphingoid Long-chain Bases in Arabidopsis: Functional Characterization and Expression of the First Sphingoid Long-chain Base Kinase Gene in Plants
Plant Cell Physiol., February 1, 2005; 46(2): 375 - 380.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Coursol, H. Le Stunff, D. V. Lynch, S. Gilroy, S. M. Assmann, and S. Spiegel
Arabidopsis Sphingosine Kinase and the Effects of Phytosphingosine-1-Phosphate on Stomatal Aperture
Plant Physiology, February 1, 2005; 137(2): 724 - 737.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
T. S. Gechev and J. Hille
Hydrogen peroxide as a signal controlling plant programmed cell death
J. Cell Biol., January 3, 2005; 168(1): 17 - 20.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. E. Mick, T. K. Starr, T. M. McCaughtry, L. K. McNeil, and K. A. Hogquist
The Regulated Expression of a Diverse Set of Genes during Thymocyte Positive Selection In Vivo
J. Immunol., November 1, 2004; 173(9): 5434 - 5444.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
T. M. DUNN, D. V. LYNCH, L. V. MICHAELSON, and J. A. NAPIER
A Post-genomic Approach to Understanding Sphingolipid Metabolism in Arabidopsis thaliana
Ann. Bot., May 1, 2004; 93(5): 483 - 497.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
X. Dong
The Role of Membrane-Bound Ankyrin-Repeat Protein ACD6 in Programmed Cell Death and Plant Defense
Sci. Signal., February 24, 2004; 2004(221): pe6 - pe6.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Research Data
Right arrow All Versions of this Article:
1140503v1
17/21/2636    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, H.
Right arrow Articles by Greenberg, J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, H.
Right arrow Articles by Greenberg, J. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Genome Res. Learn. Mem.
Protein Science RNA Genes Dev.
Copyright © 2003 by Cold Spring Harbor Laboratory Press.