|
|
|
RESEARCH PAPER
Department of Biochemistry and Molecular Biology, Peking University Health Science Center, Beijing 100083, China
| Abstract |
|---|
|
|
|---|
B. Despite phenotypic manifestations in gene knockout mice for SRC-1, GRIP1, and AIB1 of the SRC (Steroid Receptor Coactivator) family indicating their differential roles in animal physiology, there is no clear evidence, at the molecular level, to support a functional specificity for these proteins. We demonstrated in this report that two species of SRC coactivators, either as AIB1:GRIP1 or as AIB1:SRC-1 are recruited, possibly through heterodimerization, on the promoter of genes that contain a classical hormone responsive element (HRE). In contrast, on non-HRE-containing gene promoters, on which steroid receptors bind indirectly, either GRIP1 or SRC-1 is recruited as a monomer, depending on the cellular abundance of the protein. Typically, non-HRE-containing genes are early genes activated by steroid receptors, whereas HRE-containing genes are activated later. Our results also showed that SRC proteins contribute to the temporal regulation of gene transcription. In addition, our experiments revealed a positive correlation between AIB1/c-myc overexpression in ER+ breast carcinoma samples, suggesting a possible mechanism for AIB1 in breast cancer carcinogenesis.
[Keywords: Gene regulation; coactivators; steroid receptors]
Received February 16, 2004; revised version accepted May 21, 2004.
The physiological significance of the SRC family and the functional specificity of these proteins have been an area of extensive study. In this context, AIB1 has been found to be strongly amplified and/or overexpressed in 64% of primary breast cancers as well as in some primary ovarian tumors (Anzick et al. 1997
; Bautista et al. 1998
); and translocation between the GRIP1 gene and the MOZ (monocytic zinc finger) gene encoding a HAT protein (Champagne et al. 2001
) has been identified in human acute myeloid leukemia (Carapeti et al. 1998
), suggesting important functions of SRC proteins in physiology. Genetic studies with gene ablation showed that, whereas both male and female SRC1-null mice are viable and fertile, they exhibit partial resistance to several hormones, including estrogen, progestin, androgen, and thyroid hormones (Xu et al. 1998
; Weiss et al. 1999
); elimination of AIB1 has revealed that it is required for normal mouse growth (Wang et al. 2000
; Xu et al. 2000
), as well as for some female reproductive functions (Xu et al. 2000
); and, in contrast to SRC-1 and AIB1 knockout mice, there is impairment of fertility in both male and female GRIP1-null mice (Gehin et al. 2002
). A recent study showed that GRIP-null mice are protected against obesity and display enhanced adaptive thermogenesis, whereas SRC-1-null mice are prone to obesity due to reduced energy expenditure (Picard et al. 2002
).
Despite the variation in phenotypic manifestations of these SRC-null mice, which suggests differential biological activities of the SRC proteins, there is as yet no clear evidence, at the molecular level, to indicate functional specificities for the three members of the SRC family. Structurally, SRC-1, GRIP1, and AIB1 share 40% overall sequence identity, and they all contain, in the N terminus, a basic helix-loop-helix (bHLH) domain that is known as a dimerization and DNA interaction domain as well as a PAS domain, which is known to be involved in protein-protein interaction. Three LXXLL motifs, also known as NR boxes (for nuclear receptor binding), are centrally located in all three proteins (Heery et al. 1997
; Darimont et al. 1998
; McInerney et al. 1998
). Although various biochemical approaches have implied that an individual member of the SRC family may possess functional specificities in a manner of propensity or selectivity for different types or isotypes of nuclear receptors or other transcription factors (Kraichely et al. 2000
; Issa et al. 2001
; Barkhem et al. 2002
; Beischlag et al. 2002
; Bommer et al. 2002
), most in vitro studies and transfection experiments indicate that each member of the SRC family is capable of interaction with multiple nuclear receptors, and that a particular nuclear receptor is able to interact with all three members of the SRC family.
Nuclear receptors, especially steroid receptors such as ER and androgen receptor (AR), exhibit a bimodal pattern of gene regulation in the presence of their ligands. Some genes are activated quickly and others are only activated by prolonged stimulation with the ligands. In addition, tissue-specific activities have been well recognized for nuclear receptors, and these clearly are a reflection of their differential gene regulation in different tissues. However, how the precise regulation of gene expression is achieved, and, as important players in nuclear receptor signaling, how SRC proteins, as a whole family, contribute to the temporal regulation of transcription and to the tissue-specific functions of nuclear receptors, are not understood.
In this report, we investigated the functional specificity of all three members of the SRC family and provided the mechanistic and pathobiological insights into the temporal gene regulation by steroid receptors.
| Results |
|---|
|
|
|---|
To investigate whether there are any coactivation specificities for these three coactivators in ER- and AR-mediated gene transcription, we first sought to investigate the pattern of SRC-1, GRIP1, and AIB1 recruitment on different gene promoters. The estrogen-dependent human mammary carcinoma cell line T-47D and the human endometrial carcinoma cell line ECC-1, and an androgen-responsive human prostate carcinoma cell line LnCAP, were used for this experiment. EBAG9 and c-Myc were chosen to represent HRE-containing target genes and non-HRE-containing target genes, respectively, in ER-mediated transcription, and PSA and c-Myc were chosen to represent HRE-containing target genes and non-HRE-containing target genes, respectively, in AR-mediated transcription. The temporal difference in steroid-induced expression of these genes was confirmed first in our experimental system. In these experiments, T-47D cells and ECC-1 cells were grown in the absence of estrogen, and LnCAP cells were grown in the absence of androgen, for at least 3 d, followed by no treatment or treatment with saturating levels of 17
-estradiol (E2) or dihydrotestosterone (DHT) for 6 h, and the mRNA expression of c-Myc, EBAG9, and PSA was analyzed at different times of treatments by real-time RT-PCR. These experiments indicated that c-Myc activation occurred much earlier and peaked at 1 h of E2 or DHT treatment in these cells, whereas EBAG9 and PSA activation developed later and peaked at 4-6 h of E2 or DHT treatment (Supplementary Fig. 1). We then investigated the coactivator recruitment on the promoter of these genes. In these experiments, T-47D cells and ECC-1 cells were grown in the absence of estrogen, and LnCAP cells were grown in the absence of androgen, for at least 3 d, followed by no treatment or treatment with saturating levels of E2 or DHT for 45 min. The presence of SRC family coactivators on the estrogen or androgen target gene promoters was first determined using chromatin immunoprecipitation (ChIP) with antibodies against one of the coactivators. Then, both the precipitates and the supernatants were subjected to reimmunoprecipitation (ChIP/Re-IP) with antibodies against a second SRC protein. As shown in Figure 1A (top), the presence of all three members of the SRC family (SRC-1, GRIP1, and AIB1) could be detected on the promoter of the EBAG9 gene after treatment with E2. This could be explained by one of the following scenarios: each coactivator could be associated with a different promoter in different cells; pairs of three coactivators could be associated with a different promoter in different cells; or the three coactivators could act as a triplet. As mentioned earlier, the SRC proteins contain bHLH and PAS domains, which are known for mediating protein-protein interactions. Thus, dimerization or trimerization of SRC proteins is also possible. Our ChIP/Re-IP experiments demonstrate that in precipitates, whereas the EBAG9 gene promoter immunoprecipitated with antibodies against AIB1 could be reimmunoprecipitated with antibodies against either SRC-1 or GRIP1, an initial ChIP with antibodies against either SRC-1 or GRIP1 only gave detection of the EBAG9 gene promoter when reimmunoprecipitated with antibodies against AIB1 (Fig. 1A, bottom three panels, left). On the other hand, supernatants from ChIP with antibodies against AIB1 showed no detection of the EBAG9 gene promoter when ChIP/Re-IP was done with antibodies against either SRC-1 or GRIP1. In contrast, supernatants from initial ChIPs with antibodies against either SRC-1 or GRIP1 still contained AIB1- and GRIP1-bound or AIB1- and SRC-1-bound EBAG9 gene promoters, respectively (Fig. 1A, bottom three panels, right). To rule out the potential cross-reaction among these antibodies, in vitro-translated SRC proteins or cell extracts containing endogenous SRCs were immunoprecipitated by SRC antibodies. Triplicate blots containing precipitated SRC proteins resolved by SDS-PAGE were probed with antibodies against SRC-1, GRIP1, or AIB1. Antibody specificities were clearly demonstrated by these studies (data not shown). These data strongly suggested that a pair between AIB1 and SRC-1 or between AIB1 and GRIP1 existed on the promoter of the EBAG9 gene. Similar results were obtained with the PSA gene promoter in LnCAP cells (Fig. 1B) as well as with the EBAG9 gene promoter in ECC-1 cells (data not shown). The association of AR or ER with SRC-1, GRIP1, or AIB1 was confirmed by coimmunoprecipitations (see Supplementary Fig. 2). Collectively, these data indicate that, on genes that are activated late and that harbor classical ERE(s) or ARE(s) to which ER or AR directly bind, two molecules of SRC proteins, either as AIB1:SRC-1 or as AIB1:GRIP1, are recruited.
|
|
4 h after E2 treatment in T-47D cells; Supplementary Fig. 1), no recruitment of SRC proteins was detected on c-Myc promoter, whereas on EBAG9 promoter, the recruitment of SRC proteins was still detected (Fig. 3A), suggesting that the temporal gene activation is correlated to the coactivator recruitment. To determine the requirement for ER in E2-induced c-Myc expression and SRC protein recruitment, ER
expression was silenced by RNA interference (RNAi), and the expression of c-Myc and the recruitment of SRC-1 on the promoter of c-Myc gene were examined in ECC-1 cells. As shown in Figure 3B, silencing the expression of ER
rendered no significant stimulation of c-Myc expression by E2 and no recruitment of SRC-1 on the promoter of c-Myc gene, indicating that E2-induced c-Myc expression is dependent on ER
and the recruitment of SRC-1 in ECC-1 cells. The
-actin gene expression was also measured as a control (see Supplementary Fig. 3). In addition, our previous experiments (Shang et al. 2000
|
bHLH), the PAS domain (subGRIP1
PAS), or both the bHLH and the PAS domains (subGRIP1
bHLH + PAS; Fig. 4A). We then tested the effects of these mutants on ER-mediated transcription after treatment with tamoxifen, an ER antagonist. We reasoned that if a dimerization is needed between SRC proteins in ER-mediated transcription of HRE-containing genes and the dimerization occurs through the bHLH and/or PAS domain, the subGRIP1 mutants will no longer be able to coactivate the transcription of these genes. In these experiments, T-47D cells were transfected with either subGRIP1
bHLH, subGRIP1
PAS, or subGRIP1
bHLH + PAS, and then treated with a saturating level of tamoxifen for different periods of time. The expression of c-Myc and EBAG9 genes was measured by real-time RT-PCR. As shown in Figure 4B, although all of the mutants of subGRIP1 had minimal effect on tamoxifen-stimulated c-Myc expression, deletion of either the bHLH domain (bHLH del) or the PAS domain (PAS del) resulted in a decreased EBAG9 expression, although the effect of the PAS domain deletion was greater, indicating that both bHLH and PAS domains are necessary, but not sufficient in gene coactivation. In supporting this notion, the bHLH and PAS double-deletion (bHLH + PAS del) resulted in a diminished gene coactivation. ChIP analyses showed that, on c-Myc gene promoter, GRIP1 was the only SRC coactivator recruited in all subGRIP-, subGRIP1
bHLH-, subGRIP1
PAS-, and subGRIP1
bHLH + PAS-transfected cells, whereas on EBAG9 promoter, although consistent levels of GRIP1 recruitment was observed in all subGRIP1-, subGRIP1
bHLH (bHLH del)-, subGRIP1
PAS (PAS del)-, and subGRIP1
bHLH + PAS-transfected cells, the recruitment of AIB1 was much weaker in subGRIP1
bHLH (bHLH del)- and subGRIP1
PAS (PAS del)-transfected cells and was diminished in subGRIP1
bHLH + PAS-transfected cells (Fig. 4C). The expression of the sub-GRIP1 and its mutants was verified by Western blotting in Figure 4D. These experiments further support the observations that SRC proteins function on the c-Myc gene as a monomer, but that two species of the SRC proteins participate in coactivating the EBAG9 gene. More importantly, these experiments strongly favor a molecular module, in which two members of the SRC family act through their interaction via bHLH and PAS domains on the EBAG9 gene promoter.
|
|
To further solidify this argument, as well as to ask the question whether the recruitment of SRC-1 or GRIP1 on non-HRE-containing promoters is merely a result of the level of their expression or a reflection of their intrinsic specifications, we first examined the role of AIB1 in c-Myc gene expression and the promoter recruitment of AIB1 on the c-Myc gene in other ER-positive mammary carcinoma cell lines (MCF-7 and ZR-75-1), in which the AIB1 gene is amplified and overexpressed (Anzick et al. 1997
). We reasoned that, if the participation and coactivation of the non-HRE-containing genes by a SRC protein is linked to its higher level of expression, then AIB1 should be involved in c-Myc gene transactivation in these cells. As shown in Figure 6A (left), the expression level of AIB1 in both MCF-7 cells and ZR-75-1 cells was much higher than that in T-47D cells. ChIP experiments demonstrated that, in addition to the association of SRC-1, AIB1 was also present on the promoter of the c-Myc gene in both MCF-7 and ZR-75-1 cells (Fig. 6A, right). This is in contrast to the results in T-47D cells, in which only SRC-1 was present on the c-Myc gene promoter (Fig. 2A, top). ChIP/Re-IP experiments demonstrated that AIB1 acts as a monomer in these cells rather than as a possible dimer with SRC-1, as SRC-1 was only found in the supernatants, but not in the immunoprecipitates from the first immunoprecipitation with antibodies against AIB1 (Fig. 6A, right). The same was true for SRC-1. RNAi experiments demonstrated that, both in MCF-7 cells and in ZR-75-1 cells, inhibition of the expression of either AIB1 or SRC-1 resulted in a decreased expression of the c-Myc gene, whereas the effect of the inhibition of GRIP1 expression was negligible (Fig. 6B). This is consistent with the recruitment pattern of the SRC proteins (Fig. 6A, right). In addition, c-Myc gene expression was almost totally abolished in ZR-75-1 cells with an AIB1 and SRC-1 double-knockdown (Fig. 6D). These results strongly suggest that the level of expression of SRC proteins is sufficient in determining the participation of a specific coactivator on a non-HRE-containing early gene.
|
As stated before, AIB1 amplification and/or overexpression is a common observation in primary breast cancer (Anzick et al. 1997
; Bautista et al. 1998
). However, whether or how such genetic/epigenetic alterations are associated with breast cancer carcinogenesis is not understood. Analogously, c-Myc amplification/overexpression has also been documented in
30% of breast carcinomas (Guerin et al. 1988
; Bieche et al. 1999
; Chrzan et al. 2001
; Naidu et al. 2002
). In light of our observation that overexpression of AIB1 led to an increased level of c-Myc expression, it is logical to postulate that the amplification/overexpression of c-Myc may be linked to the amplification/overexpression of AIB1 in primary breast carcinomas. To validate this hypothesis, we collected ER+ (n = 76) and ER- (n = 38) breast tumor samples from breast cancer patients for whom complete information on clinical tumor size, nodal status, and ER status was available. The expression of AIB1 and c-Myc mRNAs was analyzed by real-time RT-PCR in these samples. The relative level of AIB1 expression is plotted against the relative level of c-Myc expression (GAPDH expression was measured as the internal control). Statistical analysis with the SAS system found a Spearman correlation coefficient of 0.70661 (P < 0.0001) and a Kendall Tau b correlation coefficient of 0.52279 (P < 0.0001), indicating a strong positive correlation between the expression of AIB1 and the expression of c-Myc in the ER+ breast carcinomas, whereas in ER- breast carcinomas, there was no clear correlation (Fig. 7A).
|
| Discussion |
|---|
|
|
|---|
The phenotypes of the gene knockout mice for SRC-1 (Xu et al. 1998
), AIB1 (Wang et al. 2000
; Xu et al. 2000
) and GRIP1 (Gehin et al. 2002
) have shown that the SRC family is not only required for the normal development of the reproductive system, but is also important in the development of other systems. Along with the amplification/overexpression of AIB1 in primary breast/ovarian cancers (Anzick et al. 1997
; Bautista et al. 1998
), and GRIP1-MOZ fusion in human acute myeloid leukaemia (Carapeti et al. 1998
), the importance of the SRC family extends to the maintenance of normal physiology. These observations are also an indication of functional specificities for members of the SRC family. However, such specificities have been difficult to demonstrate at the molecular level. Although different selectivities for different members of the SRC family have been reported for different types/isotypes of nuclear receptors and other transcription factors (Kraichely et al. 2000
; Issa et al. 2001
; Barkhem et al. 2002
; Beischlag et al. 2002
; Bommer et al. 2002
), most in vitro studies and transfection experiments have demonstrated that each member of the SRC family is capable of interaction with multiple nuclear receptors, and that a particular nuclear receptor is able to interact with all three members of the SRC family. We demonstrated here that there is a concerted recruitment pattern for the SRC proteins in ER- and AR-mediated transcription. Specifically, it was shown that, on classical HRE-containing late gene promoters, one pair of SRC proteins is recruited with either SRC-1 or GRIP1, possibly partnered with AIB1, whereas on the promoter of early genes that lack a classical HRE, SRC proteins are recruited as a monomer (Fig. 7B).
It is unclear what makes AIB1 a possible common dimerization partner for SRC-1 and GRIP1, as there are no identifiable distinctions in the structure and functional domains among members of the SRC family. Nonetheless, dimerization between SRC proteins has long been speculated because of the existence of protein-protein dimerization/interaction domains in these proteins. Using a chimeric GRIP1 protein and its mutants, we showed that these two domains are required for coactivation of EBAG9, an HRE-containing gene, by the SRC proteins, supporting the observations that two different molecules from the SRC family participate in the coactivation of these genes, and that these two domains are involved in SRC dimerization in vivo. However, an alternative possibility still exists that interactions may occur through coactivators such as CoCoA (Kim et al. 2003
).
It is puzzling why both AIB1:SRC-1 and AIB1:GRIP1 pairs are recruited on the promoter of the same gene, as this raises a question of functional redundancy for SRC-1 and GRIP1. However, our results are consistent with the previous observation that there is a compensatory up-regulation of GRIP1 expression in SRC-1 knockout mice in reproductive organs such as uterus, prostate, testis, and mammary gland (Xu et al. 1998
). Another obvious, but unanswered question, is why transactivation of classical HRE-containing late genes needs two molecules of the SRC family. A transcription complex in ER- or AR-mediated transcription contains receptor dimer(s), general coactivators, SRC proteins, and methyltransferases, as well as other coactivators and mediators (Lemon and Freedman 1999
; Glass and Rosenfeld 2000
; Shang et al. 2000
, 2002
; Rachez and Freedman 2001
). Along with the basal transcription machinery, the transcription edifice is already complex enough. The rate-limiting step in transcription is transcription initiation and, thus, it is only a speculation that the complexity of transcription initiation calls for a complicated transcription complex, which, in turn, needs additional factors to build and to support. Among these factors, SRC family are pivotal, at least in ER-mediated transcription, as we reported earlier (Shang et al. 2000
). Finally, a direct interaction between SRC coactivators was not detected by in vitro GST pull-down and in vivo IP experiments. However, such a stable complex may only exist in vivo in the context of a chromatin structure, in which case, the detection is beyond the capability of current methodologies.
The mechanism of differential gene regulation by SRC family
Contrary to the classical HRE-containing late gene promoters, the SRC family is recruited on non-HRE-containing early gene promoters as a monomer. The recruitment of a particular member of the SRC family appears to be determined by the level of expression of the particular protein. Although AIB1, acting as a common partner with SRC-1 and GRIP1 on HRE-containing promoters, is not recruited on non-HRE-containing promoters in the cells we tested, overexpression of AIB1 could lead to its recruitment and transcription activation in these cells.
The observation that AIB1 is involved in the transactivation of non-HRE-containing genes such as c-Myc in cells with AIB1 amplification and overexpression is interesting. As stated before, AIB1 has been found to be amplified/overexpressed in 64% of primary breast cancers as well as in some primary ovarian tumors (Anzick et al. 1997
; Bautista et al. 1998
). However, whether and how this genetic/epigenetic change in the AIB1 gene is in any way associated with breast cancer carcinogenesis is not understood. It is intriguing to speculate that AIB1 overexpression could lead to the coactivation of genes such as c-Myc, which is normally only coactivated by SRC-1 in mammary tissue. In this context, it is worthy to note that c-Myc overexpression is commonly found in breast/prostate carcinomas (Guerin et al. 1988
; Bieche et al. 1999
; Chrzan et al. 2001
; Naidu et al. 2002
), and c-Myc has been implicated in cell growth, proliferation, apoptosis, and malignant transformation, including breast cancer carcinogenesis (D'Cruz et al. 2001
; Nasi et al. 2001
; Yu et al. 2001
).
Steroid receptors such as ER and AR target different sets of genes or classes of genes. Some genes, such as c-Myc, are early genes that are activated quickly; others, such as EBAG9 and PSA, are activated later. Mechanisms must have evolved to produce precise temporal regulation of transcription. It is clear that one of the mechanisms is ER indirect binding to the promoter of early genes. By binding to other transcription factors instead of assembling itself on DNA, ER or AR could conveniently add itself to a possibly preformed transcription complex and thereby readjust the rate of transcription. In this case, the selection for association of a SRC protein with ER or AR could also be conveniently determined by the abundance of a particular member of the SRC family. On the other hand, the activation of HRE-containing genes needs assembly of a new transcription complex with receptor binding to DNA first. Such a process needs more factors and takes a longer time, and thus, two members of the SRC family are recruited and transcription occurs later. In this regard, it is conceivable that a mechanism has evolved to maintain a balanced abundance of SRC proteins inside a cell to sustain the precise temporal regulation of transcription. Future investigations are needed to elucidate this mechanism.
| Materials and methods |
|---|
|
|
|---|
Total cellular protein was separated on 7.5% SDS-PAGE and transferred to nitrocellulose membranes, which were then incubated with primary antibodies. After adding appropriate secondary antibodies, the blots were developed using an ECL kit (Amersham). Antibodies used in this experiment were
AIB1 (affinity-purified rabbit polyclones),
GRIP1 (affinity-purified rabbit polyclones),
SRC-1 (a mouse monoclone), and anti-
-galactosidase (a mouse monoclone).
ChIP
The ChIP experiments were performed essentially the same as described previously (Shang et al. 2000
, 2002
; Shang and Brown 2002
). The primers for ChIP were c-Myc (-95 to -245) forward primer (AGGCGCGCGTAGTTAATTCAT) and c-Myc reverse primer (CGCCCTCTGCTTTGGGA); IGF-I (-111 to -312) forward primer (TTGTCACCATGCCCAAAAAA) and IGF-I reverse primer (TTGCGCAGGCTCTATCTGC); PSA (-39 to -250) forward primer (TCTGCCTTTGTCCCCTAGAT) and PSA reverse primer (AACCTTCATTCCCCAGGACT); and EBAG9 (-182 to +72) forward primer (ATTGTCTGCCCTTC GCCGT) and EBAG9 reverse primer (TTTGGAGGCTGCGT GCTTT).
ChIP/Re-IP
ChIP/Re-IPs on supernatants were done essentially the same as primary IPs. Bead eluates from the first immunoprecipitation were incubated with 10 mM DTT at 37°C for 30 min and diluted 1:50 in dilution buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris-HCl at pH 8.1) followed by reimmunoprecipitation with the second antibodies.
Construction of subGRIP1 mutants
The construction of a CoRNR box-containing GRIP1 (sub-GRIP1) has been described elsewhere (Shang et al. 2000
). subGRIP1 mutants were created by PCR with subsequent ligation of the N-terminal fragment and the C-terminal fragment. The PCR primers for creating subGRIP1
bHLH were 5' primer (GCTAGCTAGCGCAGCAGCTGCCAACATAGAT) and 3' primer (GCGCGAATTCTCAGCAGTATTTCCGAG). The PCR primers for creating subGRIP1
PAS were N-terminal fragment, 5' primer (GCTAGCTAGCATGAGTGGGATGGGA) and 3' primer (GCGCGGTACCCAGGTTCTTGACAAATTC). C-terminal fragment, 5' primer (GCGCGGTACCCAGTCCT GCTTGATTTGT) and 3' primer (GCGCGAATTCTCAGCAG TATTTCCGAG). The resultant products were inserted into NheI and EcoRI sites of the pcDNA3.1(-) plasmid (Invitrogen).
Real-time reverse transcriptase (RT-PCR)
The ABI PRIZM 7700 Sequence Detector and the TaqMan EZ RT-PCR Kit (Applied Biosystem) were used for real-time RT-PCR experiments. The primers and probes used were c-Myc forward primer, GCCACGTCTCCACACATCAG; c-Myc reverse primer, TCTTGGCAGCAGGATAGTCCTT; and c-Myc probe, 6FAM-ACGCAGCGCCTCCCTCCACTC-TAMRA. IGF-I forward primer, TGCTTCCGGAGCTGTGATC; IGF-I reverse primer, AGCTGACTTGGCAGGCTTGA; and IGF-I probe, 6FAM-AGGAGGCTGGAGATGTATTGCGCACC-TAMRA. EBAG9 forward primer, GATGCACCCACCAGTG TAAAGA; EBAG9 reverse primer, AGTCAGGTTCCAGTT GTTCCAAAG; and EBAG9 probe, 6FAM-AGGAGGGAATGG GAATGTGGCAACAC-TAMRA. PSA forward primer, TGTCT CGGATTGTGGGAGG; PSA reverse primer, CACAAGCACC TGCCAGGG; and PSA probe, 6FAM-TGGGAGTGCGAGAA GCATTCCCA-TAMRA.
RNAi
Vector-based RNAi was utilized. Vectors were constructed by inserting a synthesized 64-mer oligonucleotide containing a specific sequence for SRC-1, GRIP1, or AIB1 into pSUPER vector (Brummelkamp et al. 2002
). For SRC-1, the sequence was 5'-CCTCAGGGCAGAGAACCATC-3'; for GRIP1, the sequence was 5'-CCTGGAAGGCAACGTTGTG-3'; and for AIB1, the sequence was 5'-GATATAATCCGAAGGTGTA-3'. Each of these sequences was synthesized in reverse orientation spaced by 6 nucleotides in the 64-mer oligonucleotide. After annealing into a double strand followed by phosphorylation, the 64-mer was ligated into the pSUPER vector. The vector was then transfected into cells with the LIPOFECTAMINE 2000 Reagent (Invitrogen Corp.). Forty-eight hours after transfection, cells were treated with E2 or DHT for different times. The TRIZOL reagent was used to extract total RNA for measuring mRNA level by real-time RT-PCR. Transfection efficiency was monitored by cotransfection with an Escherichia coli lacZ construct (pcDNA4/His/Max/lacZ; Invitrogen Corp.).
Tissue samples
Breast cancer tissues were obtained from surgical specimens from patients with breast cancer. Samples were selected from patients for whom complete information on clinical tumor size, nodal status, and ER status was available. Samples were frozen in liquid nitrogen immediately after surgical removal and maintained at -80°C until use for RNA extraction. All studies were approved by the Ethics Committee of the Peking University Health Science Center.
| Acknowledgments |
|---|
|
|
|---|
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
| Footnotes |
|---|
Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/gad.1194704.
1 These authors contributed equally to this work. ![]()
2 Corresponding author.
E-MAIL jason{at}bjmu.edu.cn; FAX 86-10-82801355. ![]()
| References |
|---|
|
|
|---|
Augereau, P., Miralles, F., Cavailles, V., Gaudelet, C., Parker, M., and Rochefort, H. 1994. Characterization of the proximal estrogen-responsive element of human cathepsin D gene. Mol. Endocrinol. 8: 693-703.[Abstract]
Barkhem, T., Haldosen, L.A., Gustafsson, J.A., and Nilsson, S. 2002. Transcriptional synergism on the pS2 gene promoter between a p160 coactivator and estrogen receptor-
depends on the coactivator subtype, the type of estrogen response element, and the promoter context. Mol. Endocrinol. 16: 2571-2581.
Bautista, S., Valles, H., Walker, R.L., Anzick, S., Zeillinger, R., Meltzer, P., and Theillet, C. 1998. In breast cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with estrogen and progesterone receptor positivity. Clin. Cancer Res. 4: 2925-2929.[Abstract]
Beischlag, T.V., Wang, S., Rose, D.W., Torchia, J., Reisz-Porszasz, S., Muhammad, K., Nelson, W.E., Probst, M.R., Rosenfeld, M.G., and Hankinson, O. 2002. Recruitment of the NCoA/SRC-1/p160 family of transcriptional coactivators by the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear translocator complex. Mol. Cell. Biol. 22: 4319-4333.
Bieche, I., Laurendeau, I., Tozlu, S., Olivi, M., Vidaud, D., Lidereau, R., and Vidaud, M. 1999. Quantitation of MYC gene expression in sporadic breast tumors with a real-time reverse transcription-PCR assay. Cancer Res. 59: 2759-2765.
Bieche, I., Parfait, B., Tozlu, S., Lidereau, R., and Vidaud, M. 2001. Quantitation of androgen receptor gene expression in sporadic breast tumors by real-time RT-PCR: Evidence that MYC is an AR-regulated gene. Carcinogenesis 22: 1521-1526.
Bommer, M., Benecke, A., Gronemeyer, H., and Rochette-Egly, C. 2002. TIF2 mediates the synergy between RAR
1 activation functions AF-1 and AF-2. J. Biol. Chem. 277: 37961-37966.
Brummelkamp, T.R., Bernards, R., and Agami, R. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296: 550-553.
Carapeti, M., Aguiar, R.C., Goldman, J.M., and Cross, N.C. 1998. A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia. Blood 91: 3127-3133.
Champagne, N., Pelletier, N., and Yang, X.J. 2001. The monocytic leukemia zinc finger protein MOZ is a histone acetyltransferase. Oncogene 20: 404-409.[CrossRef][Medline]
Chen, D., Huang, S.M., and Stallcup, M.R. 2000. Synergistic, p160 coactivator-dependent enhancement of estrogen receptor function by CARM1 and p300. J. Biol. Chem. 275: 40810-40816.
Chrzan, P., Skokowski, J., Karmolinski, A., and Pawelczyk, T. 2001. Amplification of c-myc gene and overexpression of c-Myc protein in breast cancer and adjacent non-neoplastic tissue. Clin. Biochem. 34: 557-562.[CrossRef][Medline]
Cleutjens, K.B., van Eekelen, C.C., van der Korput, H.A., Brinkmann, A.O., and Trapman, J. 1996. Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. J. Biol. Chem. 271: 6379-6388.
Cleutjens, K.B., van der Korput, H.A., van Eekelen, C.C., van Rooij, H.C., Faber, P.W., and Trapman, J. 1997. An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol. Endocrinol. 11: 148-161.
Darimont, B.D., Wagner, R.L., Apriletti, J.W., Stallcup, M.R., Kushner, P.J., Baxter, J.D., Fletterick, R.J., and Yamamoto, K.R. 1998. Structure and specificity of nuclear receptor-coactivator interactions. Genes & Dev. 12: 3343-3356.
D'Cruz, C.M., Gunther, E.J., Boxer, R.B., Hartman, J.L., Sintasath, L., Moody, S.E., Cox, J.D., Ha, S.I., Belka, G.K., Golant, A., et al. 2001. c-MYC induces mammary tumorigenesis by means of a preferred pathway involving spontaneous Kras2 mutations. Nat. Med. 7: 235-239.[CrossRef][Medline]
Dubik, D. and Shiu, R.P. 1992. Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7: 1587-1594.[Medline]
Gehin, M., Mark, M., Dennefeld, C., Dierich, A., Gronemeyer, H., and Chambon, P. 2002. The function of TIF2/GRIP1 in mouse reproduction is distinct from those of SRC-1 and p/CIP. Mol. Cell. Biol. 22: 5923-5937.
Glass, C.K. and Rosenfeld, M.G. 2000. The coregulator exchange in transcriptional functions of nuclear receptors. Genes & Dev. 14: 121-141.
Guerin, M., Barrois, M., Terrier, M.J., Spielmann, M., and Riou, G. 1988. Overexpression of either c-myc or c-erbB-2/neu proto-oncogenes in human breast carcinomas: Correlation with poor prognosis. Oncogene Res. 3: 21-31.[Medline]
Heery, D.M., Kalkhoven, E., Hoare, S., and Parker, M.G. 1997. A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387: 733-736.[CrossRef][Medline]
Issa, L.L., Leong, G.M., Barry, J.B., Sutherland, R.L., and Eisman, J.A. 2001. Glucocorticoid receptor-interacting protein-1 and receptor-associated coactivator-3 differentially interact with the vitamin D receptor (VDR) and regulate VDR-retinoid X receptor transcriptional cross-talk. Endocrinology 142: 1606-1615.
Kim, J.H., Li, H., and Stallcup, M.R. 2003. CoCoA, a nuclear receptor coactivator which acts through an N-terminal activation domain of p160 coactivators. Mol. Cell 12: 1537-1549.[CrossRef][Medline]
Koh, S.S., Chen, D., Lee, Y.H., and Stallcup, M.R. 2001. Synergistic enhancement of nuclear receptor function by p160 coactivators and two coactivators with protein methyltransferase activities. J. Biol. Chem. 276: 1089-1098.
Kraichely, D.M., Sun, J., Katzenellenbogen, J.A., and Katzenellenbogen, B.S. 2000. Conformational changes and coactivator recruitment by novel ligands for estrogen receptor-
and estrogen receptor-
: Correlations with biological character and distinct differences among SRC coactivator family members. Endocrinology 141: 3534-3545.
Lemon, B.D. and Freedman, L.P. 1999. Nuclear receptor cofactors as chromatin remodelers. Curr. Opin. Genet. Dev. 9: 499-504.[CrossRef][Medline]
Louie, M.C., Yang, H.Q., Ma, A.-H., Xu, W., Zou, J.X., Kung, H.-J., and Chen, H.-W. 2003. Androgen-induced recruitment of RNA polymerase II to a nuclear receptor-p160 coactivator complex. Proc. Natl. Acad. Sci. 100: 2226-2230.
McInerney, E.M., Rose, D.W., Flynn, S.E., Westin, S., Mullen, T.M., Krones, A., Inostroza, J., Torchia, J., Nolte, R.T., Assa-Munt, N., et al. 1998. Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes & Dev. 12: 3357-3368.
Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M., and Gannon, F. 2003. Estrogen receptor-
directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115: 751-763.[CrossRef][Medline]
Naidu, R., Wahab, N.A., Yadav, M., and Kutty, M.K. 2002. Protein expression and molecular analysis of c-myc gene in primary breast carcinomas using immunohistochemistry and differential polymerase chain reaction. Int. J. Mol. Med. 9: 189-196.[Medline]
Nasi, S., Ciarapica, R., Jucker, R., Rosati, J., and Soucek, L. 2001. Making decisions through Myc. FEBS Lett. 490: 153-162.[CrossRef][Medline]
Picard, F., Gehin, M., Annicotte, J.S., Rocchi, S., Champy, M.F., O'Malley, B.W., Chambon, P., and Auwerx, J. 2002. SRC-1 and TIF2 control energy balance between white and brown adipose tissues. Cell 111: 931-941.[CrossRef][Medline]
Rachez, C. and Freedman, L.P. 2001. Mediator complexes and transcription. Curr. Opin. Cell. Biol. 13: 274-280.[CrossRef][Medline]
Shang, Y. and Brown, M. 2002. Molecular determinants for the tissue specificity of SERMs. Science 295: 2465-2468.
Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A., and Brown, M. 2000. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103: 843-852.[CrossRef][Medline]
Shang, Y., Myers, M., and Brown, M. 2002. Formation of the androgen receptor transcription complex. Mol. Cell 9: 601-610.[CrossRef][Medline]
Silva, I.S., Morsch, D.M., Urnauer, L., and Spritzer, P.M. 2001. Androgen-induced cell growth and c-myc expression in human non-transformed epithelial prostatic cells in primary culture. Endocr. Res. 27: 153-169.[CrossRef][Medline]
Tsuchiya, F., Ikeda, K., Tsutsumi, O., Hiroi, H., Momoeda, M., Taketani, Y., Muramatsu, M., and Inoue, S. 2001. Molecular cloning and characterization of mouse EBAG9, homolog of a human cancer associated surface antigen: Expression and regulation by estrogen. Biochem. Biophys. Res. Commun. 284: 2-10.[CrossRef][Medline]
Umayahara, Y., Kawamori, R., Watada, H., Imano, E., Iwama, N., Morishima, T., Yamasaki, Y., Kajimoto, Y., and Kamada, T. 1994. Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1 enhancer. J. Biol. Chem. 269: 16433-16442.
Wang, Z., Rose, D.W., Hermanson, O., Liu, F., Herman, T., Wu, W., Szeto, D., Gleiberman, A., Krones, A., Pratt, K., et al. 2000. Regulation of somatic growth by the p160 coactivator p/CIP. Proc. Natl. Acad. Sci. 97: 13549-13554.
Watanabe, T., Inoue, S., Hiroi, H., Orimo, A., Kawashima, H., and Muramatsu, M. 1998. Isolation of estrogen-responsive genes with a CpG island library. Mol. Cell. Biol. 18: 442-449.