![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
RESEARCH COMMUNICATION
-globin locus requires the transcription factor EKLF
Erasmus University Medical Center, Department of Cell Biology, The Netherlands
 |
Abstract |
|---|
 Top Abstract Results and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
-globin locus. When actively expressed, the cis-regulatory elements of the -globin locus are in proximity in the nuclear space, forming a compartment termed the Active Chromatin Hub (ACH). However, it is unknown which proteins are involved in ACH formation. Here, we show that EKLF, an erythroid transcription factor required for adult -globin gene transcription, is also required for ACH formation. We conclude that transcription factors can play an essential role in the three-dimensional organization of gene loci.
[Keywords: EKLF; chromatin; spatial organization; transcription factors; globin; ACH]
Received November 18, 2003; revised version accepted August 16, 2004.
-globin locus contains multiple -like globin genes, arranged from 5' to 3' in order of their developmental expression (Fig. 1A). The adult-type maj-gene is transcribed at a very low level during primitive erythropoiesis in the embryonic yolk sac, but becomes expressed at high levels around day 11 of gestation (E11) when definitive erythropoiesis commences in the fetal liver (Trimborn et al. 1999
). The -globin locus control region (LCR) is essential for efficient globin transcription (Grosveld et al. 1987; Bender et al. 2000). It consists of a series of DNaseI hypersensitive sites (HS) located 
50 kb upstream of the maj promoter (Fig. 1A). We have shown that the -globin locus forms an Active Chromatin Hub (ACH) in erythroid cells (Tolhuis et al. 2002). The ACH is a nuclear compartment dedicated to RNA polymerase II transcription, formed by the cis-regulatory elements of the -globin locus with the intervening DNA looping out. The ACH consists of the HS of the LCR, two HS located 60 kb upstream of the embryonic 
y-globin gene (5'HS-62/-60) and 3'HS1 downstream of the genes. In addition, the actively expressed globin genes are part of the ACH (Carter et al. 2002; Tolhuis et al. 2002). In erythroid precursors that do not express the globin genes yet, a substructure of the ACH, called a chromatin hub (CH) (Patrinos et al. 2004) is found, which excludes the genes and the HS at the 3' site of the LCR (Palstra et al. 2003).
|
maj-gene requires the presence of the erythroid Krüppel-like transcription factor EKLF, the erythroid-specific member of the Sp/XKLF-family (Miller and Bieker 1993). EKLF-/- mice die of anemia around E14, because of a deficit in -globin expression (Nuez et al. 1995; Perkins et al. 1995). The -globin locus contains a number of EKLF-binding sites, in particular in the LCR and the maj-globin promoter (Perkins 1999; Bieker 2001). Because maj-globin expression depends on the presence of EKLF, we were interested in determining whether EKLF is involved in the formation of the ACH. |
Results and Discussion |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
) to investigate the three-dimensional conformation of the mouse -globin locus in the absence of EKLF. Cells from E12.5 EKLF-/- and wild-type fetal livers were cross-linked with formaldehyde, followed by restriction enzyme digestion of the DNA. The samples were ligated under conditions that favor the ligation of DNA fragments that are physically connected through the cross-links. Quantitative PCR across the junctions is used to determine the relative cross-linking frequencies between restriction fragments in the locus. This provides an indication of the nuclear proximity of DNA fragments in vivo (Dekker et al. 2002; Tolhuis et al. 2002; Palstra et al. 2003). Cross-linking frequencies were determined for a total of 66 junctions that can be formed between 12 selected HindIII fragments spread over 170 kb of DNA encompassing the -globin gene cluster (Fig. 1). Examples of quantitative PCR reactions with some of the primer combinations are shown in Figure 1B. An overview of the locus-wide cross-linking frequencies of a restriction fragment that contains the maj promoter is shown in Figure 1C. The brain serves as a nonexpressing control tissue (black curve), in which the -globin locus appears to adopt a linear conformation (Tolhuis et al. 2002). In wild-type E12.5 fetal liver cells, high cross-linking frequencies are found with the LCR and 5'HS-62, indicating their proximity to the maj promoter in vivo (blue curve). In the absence of EKLF however, these cross-linking frequencies are much lower and no interaction with a distal site stands out clearly (red curve), showing that the maj promoter does not participate stably in a spatial clustering of chromatin. A comparable pattern is observed with locus-wide cross-linking frequencies of a fragment containing 5'HS2 (Fig. 1D). Together with 5'HS3, 5'HS2 is the most prominent transcriptional activating element of the LCR (Ellis et al. 1993, 1996; Fraser et al. 1993; Fiering et al. 1995; Hug et al. 1996). Interactions with 5'HS-62, maj, 3'HS1, and the other HS of the LCR are strongly reduced in the absence of EKLF, indicating that 5'HS2 requires the presence of EKLF to participate in the ACH.
The results shown in Figure 1 demonstrate that the complete ACH is not formed in the absence of EKLF. However, the observed cross-linking frequencies in EKLF-/- fetal liver cells are still higher than those found in nonexpressing brain cells, indicating a different, nonlinear, structure. To investigate this, we compared the locus-wide cross-linking frequencies of restriction fragments containing 5'HS-62 and 5'HS4/5 (Fig. 2). These sites participate in the CH present in erythroid progenitor cells before the globin genes are transcribed (Palstra et al. 2003). Examples of quantitative PCR reactions with some of the primer combinations are shown in Figure 2A. The graphs in Figure 2B show that in wild-type fetal liver cells, 5'HS-62 is in proximity to the LCR, maj and 3'HS1. In EKLF-/- fetal liver cells, 5'HS-62 interactions with the HS at the 5' side of the LCR and with the distal 3'HS1 still stand out, whereas all other cross-linking frequencies are strongly reduced. This indicates the presence of a globin CH, containing 5'HS-62/-60, the HS at the 5' side of the LCR, and 3'HS1. The same structure is apparent when analyzing locus-wide cross-linking frequencies of a restriction fragment containing 5'HS4/5 at the 5' side of the LCR (Fig. 2C).
|
-globin locus in EKLF-/- fetal liver cells and that observed in I/11 erythroid progenitor cells that do not yet express globin (Palstra et al. 2003; Supplementary Fig. 1). This suggests that EKLF is required for progression from the chromatin hub present in erythroid precursors to a fully active ACH. To investigate whether this -globin structure in EKLF null cells is a direct consequence of EKLF deficiency or caused by a general differentiation failure, we analyzed expression of the erythroid-specific, but EKLF-independent, 
-globin gene locus. Consistent with previous observations, primary transcript in situ hybridization experiments show that -globin expressing cells are abundantly present in the EKLF-/- fetal liver, demonstrating that in the absence of EKLF cells are progressing to the stage of active globin expression (Fig. 3A) (Nuez et al. 1995; Perkins et al. 1995; Wijgerde et al. 1996; Lim et al. 1997). We do observe that EKLF-/- fetal livers contain 20% less -globin-expressing cells than wild-type fetal livers (55% vs. 70% of the total number of cells in the fetal liver). Whereas this may explain the small reduction in cross-linking frequencies observed between some of the -globin elements, it cannot account for the strongly reduced locus-wide cross-linking frequencies seen with, for example, maj and 5'HS2 (Fig. 1C,D). We conclude that the dramatically altered chromatin organisation of the -globin locus in EKLF null erythroid cells is not due to a general differentiation problem.
|
-globin locus in the absence of EKLF, we investigated interactions between the promoter and remote regulatory element of the erythroid-specific, EKLF-independent, -globin locus. The mouse -globin locus has two active genes in the fetal liver, 1 and 2, and contains a HS 26 kb upstream of the 
-globin promoter that is similar to the human -globin enhancer HS-40 (Fig. 3B; Flint et al. 2001). It is likely that, analogous to the LCR, this element will interact with the -like globin promoters to enhance expression. The cross-linking frequencies of the restriction fragments containing HS-26 and 2-globin are shown in Figure 3C and D. In wild-type and EKLF-/- fetal liver cells, the cross-linking frequencies are clearly higher than those observed in nonexpressing brain tissue, indicating that HS-26 and the 2-globin gene are in close proximity in both types of erythroid cells. The slightly reduced interaction frequencies observed in EKLF knockout compared with wild-type fetal liver can be explained by the 20% reduction of -globin expressing cells (see above). We conclude that major alterations in spatial organization are restricted to the EKLF-dependent -globin locus.
To further investigate whether changes in the spatial organization of the -globin locus are a direct effect of the activity of EKLF, we wished to induce EKLF activation and simultanously prevent it from activating secondary pathways. For this, we used a fusion between EKLF and a modified estrogen-receptor ligand-binding domain (EKLF–lbd protein), which can be activated by 4-hydroxy-tamoxifen (4-OHT) (Littlewood et al. 1995). We wanted to test whether, in an EKLF null background, activated EKLF–lbd protein restores ACH formation in the presence of the protein synthesis inhibitor cycloheximide (CHX). In such a setup, genes activated by EKLF cannot be translated into protein, and therefore any structural changes would have to be attributed to EKLF acting directly on the -globin locus.
Transgenic mice carrying an expression construct of an EKLF–lbd fusion protein were generated. To ensure expression of the fusion protein in EKLF null erythroid cells, we used the erythroid-specific pEV3 expression vector (Needham et al. 1992) and replaced the -globin promoter with the -globin promoter. Western blot analysis demonstrates the presence of the HA-tagged EKLF–lbd fusion protein (Fig. 4A). We have previously shown that an EKLF–pEV3 transgene rescues the EKLF null mutation (Tewari et al. 1998). To test whether uninduced EKLF–lbd fusion protein is inactive, we crossed the EKLF–lbd transgenics with the EKLF knockout mice. No EKLF null::EKLF–lbd transgene pups were born. When we dissected the fetuses resulting from this cross at E12.5, we found that the EKLF null::EKLF–lbd transgenic fetuses were indistinguishable from EKLF null fetuses, for example, displaying signs of severe anemia and having very pale fetal livers (data not shown). We conclude that the EKLF–lbd fusion protein is inactive and does not rescue the EKLF null mutation.
|
-globin gene transcription, we cultured EKLF null::EKLF–lbd fetal liver cells in the presence of 4-OHT (Fig. 4B). After 16 h of culturing, a subset of the cells was used to check for the activation of -globin gene expression. Real-time RT–PCR analysis of steady-state mRNA levels shows that the -globin gene is activated in EKLF null::EKLF–lbd cells in the presence of 4-OHT (Fig. 4C). The amount of -globin transcripts in the tamoxifen-rescued cells is much lower than in wild-type cells, which is is not surprising, as the former cells just start to accumulate -globin mRNA levels. We conclude that the EKLF–lbd fusion protein can be induced with 4-OHT to activate -globin gene expression. Moreover, -globin gene activation by 4-OHT-induced EKLF–lbd also occurs in the presence of CHX (Fig. 4C).
The remaining cells were subjected to 3C analysis using a procedure modified for use with small numbers of cells. Because the amount of material was limiting, we focused on the analysis of interactions between 5'HS2, one of the most prominent activating elements of the LCR, and the promoter of the maj gene (Carter et al. 2002; Tolhuis et al. 2002). In untreated EKLF null fetal liver cells, we found similarly low cross-linking frequencies between 5'HS2 and maj regardless of the presence of the (uninduced) EKLF–lbd protein (Fig. 4D). In contrast, this interaction is restored in EKLF null::EKLF–lbd cells after culturing for 16 h in the presence of 4-OHT. Importantly, the same effect is also observed when CHX and 4-OHT are present simultaneously (Fig. 4D). These data indicate that ACH interactions are restored in EKLF null::EKLF–lbd cells when the EKLF–lbd fusion protein is activated by 4-OHT. Because this also occurs when protein synthesis is inhibited through the addition of CHX, we conclude that EKLF is directly involved in the completion of ACH formation.
In conclusion, our data show that a chromatin hub is formed independent of EKLF during erythropoiesis, consisting of the 5'HS-62/-60, the HS at the 5' side of the LCR, and 3'HS1. EKLF is required for the progression to, or stabilization of, a fully functional ACH, which includes the remaining HS of the LCR and the actively transcribed maj globin gene (Fig. 5). The min gene, which is also expressed in definitive erythroid cells, is known to alternate with the maj gene in the ACH in a dynamic flip-flop mechanism (Wijgerde et al. 1995; Trimborn et al. 1999). The EKLF-independent chromatin hub is structurally similar to that present in erythroid precursor cells, which were previously found to already contain EKLF mRNA (Dolznig et al. 2001) and protein (data not shown). This suggests that modifications of the EKLF protein or other protein factors are required to collaborate with EKLF in organizing a fully active -globin ACH.
|
-globin gene in the human -globin locus mildly affects ACH formation, suggesting that in addition to the -globin promoter, other cis-regulatory elements in the human -globin locus are involved in these interactions (Patrinos et al. 2004). EKLF-binding sites are also present in the LCR, in particular in 5'HS3, and in the 3' enhancer of the -globin gene (Wall et al. 1988; Gillemans et al. 1998). Together, these data suggest that the EKLF-dependent interactions of the adult -globin genes with the ACH involve multiple cis-regulatory elements.
It is also interesting to note that in the EKLF knockout, absence of spatial interactions coincides with loss of chromatin accessibility at 5'HS3 and the maj-promoter (Wijgerde et al. 1996; De Laat and Grosveld 2003). We conclude that EKLF is necessary for hypersensitive site formation and the participation of the LCR and the -globin promoter in the ACH, probably through interactions with a SWI/SNF-related chromatin remodeling complex (Armstrong et al. 1998). Thus, EKLF is the first example of a transcription factor that is required for the proper spatial organization of a mammalian gene locus.
|
Materials and methods |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
EKLF+/- mice (Nuez et al. 1995) were crossed, and E12.5 fetal livers and brains were isolated. 3C analysis was performed as described (Splinter et al. 2004), with minor adjustments. Individual liver and brain samples were subjected to formaldehyde cross-linking. HindIII restriction enzyme digestion of cross-linked DNA, intramolecular ligation, reversal of cross-links, PCR analysis of ligation products, and calculation of relative cross-linking frequencies was done with 15 pooled wild-type fetal livers, 15 EKLF-/- fetal livers and cells of three pooled EKLF-/- brains. Two independent samples were prepared for the analysis. Each PCR reaction was performed in duplicate and repeated at least three times.
-Globin
HS-26-2 promoter cross-linking frequencies were determined with the DNA samples described above and primers recognizing the HindIII restriction fragment containing HS-26 (5'-GAATCTCCATCTCCAAGGG-3') and the 2 promoter (5'-AAGAGGTGCAGGTGTATTACTG-3'). In situ hybridization of E12.5 fetal liver cells was performed as described before (Van de Corput and Grosveld 2001). Cells were scored positive if -globin mRNA, primary transcript, or both, was detected. Greater than 300 cells were counted to determine the percentage of -globin-positive cells in each sample.
Generation of EKLF–lbd transgenic mice
A DNA fragment containing EKLF cDNA and the first intron was linked in frame with the HA tag sequence at the 5' side and the lbd-coding sequence at the 3' side. This construct was cloned into the pEV3 vector (Needham et al. 1992) and the -promoter was replaced by a fragment containing the -globin promoter. The vector was linearized by AatII, and transgenic mice were generated as described (Kollias et al. 1986).
Culture of primary fetal liver cells
Livers were isolated from E12.5 control and EKLF null::EKLF–lbd tg fetuses. The genotype of the fetuses was confirmed by PCR. Single-cell suspensions of individual fetal livers were cultured for 16h in StemPro-34 containing 1% BSA, 1% glutamine, and 10 U/mL epo, but without serum supplement. The EKLF–lbd was activated by supplementing the medium with either 250 nM 4-hydroxy-tamoxifen (4-OHT) alone or with 250 nM 4-OHT and 20 µg/mL cycloheximide (CHX). After 16 h of culture, cells were harvested and a small aliquot was taken for RNA isolation. The 16-h period was chosen because it allowed detection of 4-OHT-induced -globin gene transcription without CHX causing toxic effects. Fixation of the remainder of the cells with formaldehyde and subsequent isolation of nuclei was performed as described before (Tolhuis et al. 2002).
Preparation of cDNA and Real-time PCR
RNA was isolated using Trizol, according to the manufacturer's guidelines (Invitrogen). The Super-script reverse transcriptase Kit (Invitrogen) was used for preparation of oligo-dT primed cDNA. Expression levels were determined on the Bio-Rad I-Cycler using the qPCR Core kit for Sybr Green 1 (Eurogentec). Expression levels of Hprt were used for normalization of -globin expression levels.
Primers used were as follows: Hprt-s, AGCCTAAGATGAGCG CAAGT; Hprt-as, ATGGCCACAGGACTAGAACA; -major-s, ATGC CAAAGTGAAGGCCCAT; -major-as, CCCAGCACAATCACGATCAT.
Preparation of 3C templates
For the limiting number of cells (1.106) obtained from the individual EKLF null::EKLF–lbd tg fetal livers, we adapted the previously described protocol (Tolhuis et al. 2002).
Cross-linked nuclei of E12.5 fetal livers were resuspended in 50 µL of digestion buffer containing 0.1% SDS and incubated for 1 h at 37°C with agitation, Triton X-100 was added to 2.6%, and the nuclei were further incubated for 1 h at 37°C.
The cross-linked chromatin was digested overnight at 37°C with 10 U of HindIII. The restriction enzyme was heat inactivated (25 min at 65°C). After addition of 200 µL of 1.25x ligase buffer and 40 U of T4 ligase, the chromatin was ligated for 4.5 h at 16°C, followed by 30 min at room temperature. Proteinase K was added, and samples were incubated overnight at 65°C to reverse the cross-links. The following day, samples were incubated for 30 min with RNAse, and the DNA was purified by phenol extraction and ethanol precipitation using glycogen as a carrier. Locus-wide cross-linking frequencies of wild-type fetal livers treated with this adapted protocol were similar to those found previously (data not shown).
PCR analysis of the ligation products was performed as described before (Tolhuis et al. 2002; Palstra et al. 2003).
|
Acknowledgments |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
|
Footnotes |
|---|
Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/gad.317004.
1 These authors contributed equally to this work. 
2 Corresponding author. E-MAIL j.philipsen{at}erasmusmc.nl; FAX 31-10-4089468.
|
References |
|---|
|
TopAbstractResults and DiscussionMaterials and methodsAcknowledgmentsReferences |
|---|
Bender, M.A., Bulger, M., Close, J., and Groudine, M. 2000. -globin gene switching and DNase I sensitivity of the endogenous -globin locus in mice do not require the locus control region. Mol. Cell 5: 387-393.[CrossRef][Medline]
Bieker, J.J. 2001. Kruppel-like factors: Three fingers in many pies. J. Biol. Chem. 276: 34355-34358.
Carter, D., Chakalova, L., Osborne, C.S., Dai, Y.F., and Fraser, P. 2002. Long-range chromatin regulatory interactions in vivo. Nat. Genet. 32: 623-626.[CrossRef][Medline]
De Laat, W. and Grosveld, F. 2003. Spatial organization of gene expression: The Active Chromatin Hub. Chromosome Res. 5: 447-459.
Dekker, J., Rippe, K., Dekker, M., and Kleckner, N. 2002. Capturing chromosome conformation. Science 295: 1306-1311.
Dolznig, H., Boulme, F., Stangl, K., Deiner, E.M., Mikulits, W., Beug, H., and Mullner, E.W. 2001. Establishment of normal, terminally differentiating mouse erythroid progenitors: Molecular characterization by cDNA arrays. FASEB. J. 15: 1442-1444.
Ellis, J., Talbot, D., Dillon, N., and Grosveld, F. 1993. Synthetic human -globin 5'HS2 constructs function as locus control regions only in multicopy transgene concatamers. EMBO J. 12: 127-134.[Medline]
Ellis, J., Tan-Un, K.C., Harper, A., Michalovich, D., Yannoutsos, N., Philipsen, S., and Grosveld, F. 1996. A dominant chromatin-opening activity in 5' hypersensitive site 3 of the human -globin locus control region. EMBO J. 15: 562-568.[Medline]
Fiering, S., Epner, E., Robinson, K., Zhuang, Y., Telling, A., Hu, M., Martin, D.I., Enver, T., Ley, T.J., and Groudine, M. 1995. Targeted deletion of 5'HS2 of the murine -globin LCR reveals that it is not essential for proper regulation of the -globin locus. Genes & Dev. 9: 2203-2213.
Flint, J., Tufarelli, C., Peden, J., Clark, K., Daniels, R.J., Hardison, R., Miller, W., Philipsen, S., Tan-Un, K.C., McMorrow, T., et al. 2001. Comparative genome analysis delimits a chromosomal domain and identifies key regulatory elements in the globin cluster. Hum. Mol. Genet. 10: 371-382.
Fraser, P., Pruzina, S., Antoniou, M., and Grosveld, F. 1993. Each hypersensitive site of the human -globin locus control region confers a different developmental pattern of expression on the globin genes. Genes & Dev. 7: 106-113.
Gillemans, N., Tewari, R., Lindeboom, F., Rottier, R., de Wit, T., Wijgerde, M., Grosveld, F., and Philipsen, S. 1998. Altered DNA-binding specificity mutants of EKLF and Sp1 show that EKLF is an activator of the -globin locus control region in vivo. Genes & Dev. 12: 2863-2873.
Grosveld, F., van Assendelft, G.B., Greaves, D.R., and Kollias, G. 1987. Position-independent, high-level expression of the human -globin gene in transgenic mice. Cell 51: 975-985.[CrossRef][Medline]
Hug, B.A., Wesselschmidt, R.L., Fiering, S., Bender, M.A., Epner, E., Groudine, M., and Ley, T.J. 1996. Analysis of mice containing a targeted deletion of -globin locus control region 5' hypersensitive site 3. Mol. Cell. Biol. 16: 2906-2912.[Abstract]
Kollias, G., Wrighton, N., Hurst, J., and Grosveld, F. 1986. Regulated expression of human A 
-, -, and hybrid -globin genes in transgenic mice: Manipulation of the developmental expression patterns. Cell 46: 89-94.[CrossRef][Medline]
Lim, S.K., Bieker, J.J., Lin, C.S., and Costantini, F. 1997. A shortened life span of EKLF-/- adult erythrocytes, due to a deficiency of -globin chains, is ameliorated by human -globin chains. Blood 90: 1291-1299.
Littlewood, T.D., Hancock, D.C., Danielian, P.S., Parker, M.G., and Evan, G.I. 1995. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 23: 1686-1690.
Miller, I.J. and Bieker, J.J. 1993. A novel, erythroid cell-specific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins. Mol. Cell. Biol. 13: 2776-2786.
Needham, M., Gooding, C., Hudson, K., Antoniou, M., Grosveld, F., and Hollis, M. 1992. LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells. Nucleic Acids Res. 20: 997-1003.
Nuez, B., Michalovich, D., Bygrave, A., Ploemacher, R., and Grosveld, F. 1995. Defective hematopoiesis in fetal liver resulting from inactivation of the EKLF gene. Nature 375: 316-318.[CrossRef][Medline]
Palstra, R.J., Tolhuis, B., Splinter, E., Nijmeijer, R., Grosveld, F., and de Laat, W. 2003. The -globin nuclear compartment in development and erythroid differentiation. Nat. Genet. 35: 190-194.[CrossRef][Medline]
Patrinos, G.P., de Krom, M., de Boer, E., Langeveld, A., Imam, A.M., Strouboulis, J., de Laat, W., and Grosveld, F.G. 2004. Multiple interactions between regulatory regions are required to stabilize an active chromatin hub. Genes & Dev. 18: 1495-1509.
Perkins, A. 1999. Erythroid Kruppel like factor: From fishing expedition to gourmet meal. Int. J. Biochem. Cell. Biol. 31: 1175-1192.[CrossRef][Medline]
Perkins, A.C., Sharpe, A.H., and Orkin, S.H. 1995. Lethal -thalassaemia in mice lacking the erythroid CACCC-transcription factor EKLF. Nature 375: 318-322.[CrossRef][Medline]
Splinter, E., Grosveld, F., and de Laat, W. 2004. 3C technology: Analyzing the spatial organization of genomic loci in vivo. Methods Enzymol. 375: 493-507.[Medline]
Tewari, R., Gillemans, N., Wijgerde, M., Nuez, B., von Lindern, M., Grosveld, F., and Philipsen, S. 1998. Erythroid Kruppel-like factor (EKLF) is active in primitive and definitive erythroid cells and is required for the function of 5'HS3 of the -globin locus control region. EMBO J. 17: 2334-2341.[CrossRef][Medline]
Tolhuis, B., Palstra, R.J., Splinter, E., Grosveld, F., and de Laat, W. 2002. Looping and interaction between hypersensitive sites in the active -globin locus. Mol. Cell 10: 1453-1465.[CrossRef][Medline]
Trimborn, T., Gribnau, J., Grosveld, F., and Fraser, P. 1999. Mechanisms of developmental control of transcription in the murine - and -globin loci. Genes & Dev. 13: 112-124.
Van de Corput, M.P. and Grosveld, F.G. 2001. Fluorescence in situ hybridization analysis of transcript dynamics in cells. Methods 25: 111-118.[CrossRef][Medline]
Wall, L., deBoer, E., and Grosveld, F. 1988. The human -globin gene 3' enhancer contains multiple binding sites for an erythroid-specific protein. Genes & Dev. 2: 1089-1100.
Wijgerde, M., Grosveld, F., and Fraser, P. 1995. Transcription complex stability and chromatin dynamics in vivo. Nature 377: 209-213.[CrossRef][Medline]
Wijgerde, M., Gribnau, J., Trimborn, T., Nuez, B., Philipsen, S., Grosveld, F., and Fraser, P. 1996. The role of EKLF in human -globin gene competition. Genes & Dev. 10: 2894-2902.
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  L. Valenzuela, N. Dhillon, R. N. Dubey, M. R. Gartenberg, and R. T. Kamakaka Long-Range Communication between the Silencers of HMR Mol. Cell. Biol., March 15, 2008; 28(6): 1924 - 1935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. N. Levasseur, J. Wang, M. O. Dorschner, J. A. Stamatoyannopoulos, and S. H. Orkin Oct4 dependence of chromatin structure within the extended Nanog locus in ES cells Genes & Dev., March 1, 2008; 22(5): 575 - 580. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Siatecka, L. Xue, and J. J. Bieker Sumoylation of EKLF Promotes Transcriptional Repression and Is Involved in Inhibition of Megakaryopoiesis Mol. Cell. Biol., December 15, 2007; 27(24): 8547 - 8560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Frontelo, D. Manwani, M. Galdass, H. Karsunky, F. Lohmann, P. G. Gallagher, and J. J. Bieker Novel role for EKLF in megakaryocyte lineage commitment Blood, December 1, 2007; 110(12): 3871 - 3880. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. V. Tsytsykova, R. Rajsbaum, J. V. Falvo, F. Ligeiro, S. R. Neely, and A. E. Goldfeld Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers PNAS, October 23, 2007; 104(43): 16850 - 16855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shimotsuma, H. Matsuzaki, O. Tanabe, A. D. Campbell, J. D. Engel, A. Fukamizu, and K. Tanimoto Linear Distance from the Locus Control Region Determines {varepsilon}-Globin Transcriptional Activity Mol. Cell. Biol., August 15, 2007; 27(16): 5664 - 5672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-I. Kim, S. J. Bultman, H. Jing, G. A. Blobel, and E. H. Bresnick Dissecting Molecular Steps in Chromatin Domain Activation during Hematopoietic Differentiation Mol. Cell. Biol., June 15, 2007; 27(12): 4551 - 4565. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Kooren, R.-J. Palstra, P. Klous, E. Splinter, M. von Lindern, F. Grosveld, and W. de Laat beta-Globin Active Chromatin Hub Formation in Differentiating Erythroid Cells and in p45 NF-E2 Knock-out Mice J. Biol. Chem., June 1, 2007; 282(22): 16544 - 16552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Kyrchanova, S. Toshchakov, A. Parshikov, and P. Georgiev Study of the Functional Interaction between Mcp Insulators from the Drosophila bithorax Complex: Effects of Insulator Pairing on Enhancer-Promoter Communication Mol. Cell. Biol., April 15, 2007; 27(8): 3035 - 3043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-C. Shyu, T.-L. Lee, S.-C. Wen, H. Chen, W.-Y. Hsiao, X. Chen, J. Hwang, and C.-K. J. Shen Subcellular Transport of EKLF and Switch-On of Murine Adult {beta}maj Globin Gene Transcription Mol. Cell. Biol., March 15, 2007; 27(6): 2309 - 2323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Grass, H. Jing, S.-I. Kim, M. L. Martowicz, S. Pal, G. A. Blobel, and E. H. Bresnick Distinct Functions of Dispersed GATA Factor Complexes at an Endogenous Gene Locus. Mol. Cell. Biol., October 1, 2006; 26(19): 7056 - 7067. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dostie, T. A. Richmond, R. A. Arnaout, R. R. Selzer, W. L. Lee, T. A. Honan, E. D. Rubio, A. Krumm, J. Lamb, C. Nusbaum, et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements Genome Res., October 1, 2006; 16(10): 1299 - 1309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kim, M. Yamazaki, L. A. Zella, N. K. Shevde, and J. W. Pike Activation of Receptor Activator of NF-{kappa}B Ligand Gene Expression by 1,25-Dihydroxyvitamin D3 Is Mediated through Multiple Long-Range Enhancers. Mol. Cell. Biol., September 1, 2006; 26(17): 6469 - 6486. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Splinter, H. Heath, J. Kooren, R.-J. Palstra, P. Klous, F. Grosveld, N. Galjart, and W. de Laat CTCF mediates long-range chromatin looping and local histone modification in the beta-globin locus Genes & Dev., September 1, 2006; 20(17): 2349 - 2354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G.-L. Zhou, L. Xin, W. Song, L.-J. Di, G. Liu, X.-S. Wu, D.-P. Liu, and C.-C. Liang Active Chromatin Hub of the Mouse {alpha}-Globin Locus Forms in a Transcription Factory of Clustered Housekeeping Genes. Mol. Cell. Biol., July 1, 2006; 26(13): 5096 - 5105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Zhou, K. M. Pawlik, J. Ren, C.-W. Sun, and T. M. Townes Differential Binding of Erythroid Krupple-like Factor to Embryonic/Fetal Globin Gene Promoters during Development J. Biol. Chem., June 9, 2006; 281(23): 16052 - 16057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Pilon, D. G. Nilson, D. Zhou, J. Sangerman, T. M. Townes, D. M. Bodine, and P. G. Gallagher Alterations in expression and chromatin configuration of the alpha hemoglobin-stabilizing protein gene in erythroid kruppel-like factor-deficient mice. Mol. Cell. Biol., June 1, 2006; 26(11): 4368 - 4377. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Zella, S. Kim, N. K. Shevde, and J. W. Pike Enhancers Located within Two Introns of the Vitamin D Receptor Gene Mediate Transcriptional Autoregulation by 1,25-Dihydroxyvitamin D3 Mol. Endocrinol., June 1, 2006; 20(6): 1231 - 1247. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Fraser and J. D. Engel Constricting restricted transcription: the (actively?) shrinking web Genes & Dev., June 1, 2006; 20(11): 1379 - 1383. [Full Text] [PDF]
|
|
|
|
