QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 1172504v1 18/5/486    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Paffenholz, R. Articles by Bergstrom, D. E. Search for Related Content PubMed PubMed Citation Articles by Paffenholz, R. Articles by Bergstrom, D. E. Social Bookmarking                   What's this?

RESEARCH COMMUNICATION

Vestibular defects in head-tilt mice result from mutations in Nox3, encoding an NADPH oxidase

¹ Ingenium Pharmaceuticals AG, D-82152 Martinsried, Germany; ² The Jackson Laboratory, Bar Harbor, Maine 04609 USA; ³ GSF-National Research Center for Environmental Health, Institute of Pathology, 85764, Germany; ⁴ Genetics Unit, Department of Biochemistry, University of Oxford, Oxford OX1 3QU, UK

	Abstract

Top Abstract Results and Discussion Materials and methods Acknowledgments References

 
The vestibular system of the inner ear is responsible for the perception of motion and gravity. Key elements of this organ are otoconia, tiny biomineral particles in the utricle and the saccule. In response to gravity or linear acceleration, otoconia deflect the stereocilia of the hair cells, thus transducing kinetic movements into sensorineural action potentials. Here, we present an allelic series of mutations at the otoconia-deficient head tilt (het) locus, affecting the gene for NADPH oxidase 3 (Nox3). This series of mutations identifies for the first time a protein with a clear enzymatic function as indispensable for otoconia morphogenesis.

[Keywords: Mouse; vestibular system; otoconia; NADPH oxidase; saccule; utricle]

Received November 26, 2003; revised version accepted February 2, 2004.

Otoconia are comprised of proteinaceous and inorganic components. In mammals, the inorganic component that provides the mass and gives the otoconia their crystalline structure is primarily calcium carbonate. In addition, many of the protein components of the otoconia/matrix complex in mice are known. For example, otoconin 90 (Oc90) is the major protein component of otoconia with sequence (but most likely not functional) homology to phospholipase A2 (Wang et al. 1998, 1999). Otogelin (Otog) is a protein expressed by supporting cells and localized to the acellular membranes surrounding the otoconial crystals (Cohen-Salmon et al. 1997; El-Amraoui et al. 2001). Otoancorin (Otoa) is a protein localized at the interface of the sensory cells and the overlying acellular structures (Zwaenepoel et al. 2002). Despite this structural knowledge, the mechanisms of otoconial synthesis at the molecular level remain unclear.

To further understanding of balance and gravity perception, investigators have relied on the molecular genetic analysis of mice harboring mutations that specifically affect the vestibular system. Three classical loci are known that confer congenital and specific absence of otoconia in affected mice. Tilted-head (thd) is a classical locus mapping to mouse Chromosome 1 (Chr 1; Kelly and Hartman 1958). It has not been characterized molecularly, and to the best of our knowledge is now extinct. A second locus, tilted (tlt), resides on mouse Chr 5 and was recently identified as otopetrin 1 (Otop1; Ornitz et al. 1998; Ying et al. 1999; Hurle et al. 2001, 2003). In the present Communication, we describe the cloning and characterization of head tilt (het), a third locus, residing on Chr 17 (Sweet 1980; Bergstrom et al. 1998; Cook 1999).

Mice with the head tilt (het) mutation are characterized by impaired otoconial morphogenesis with normal functionality of the auditory system. Here we present an allelic series of mutations at the het locus (including three novel, mutagenesis-induced alleles), affecting the gene for NADPH oxidase 3 (Nox3). This series of mutations identifies for the first time a protein with a clear enzymatic function as indispensable for otoconial morphogenesis, and leads to a new model for the formation of otoconia.

	Results and Discussion

Top Abstract Results and Discussion Materials and methods Acknowledgments References

 
In the course of our recessive ENU mutagenesis screen at Ingenium (Russ et al. 2002; Stumm et al. 2002) and our ES-cell EMS mutagenesis screen at The Jackson Laboratory (Munroe et al. 2000), animals from three independent lines (designated R96, R542, and vst) were identified with balance defects. These mice were characterized by an abnormally "tilted" position of the head (Fig. 1A) and abnormal performance in several motor coordination tests. The traits showed Mendelian recessive inheritance.

View larger version (119K): [in this window] [in a new window]   Figure 1. Typical features of R96, R542, and vst mutant mice. (A) Tilted position of the head (affected mouse). (B) Unaffected control. In both A and B, the angle of the head is shown in the inset. (C) Unable to swim or float in forced swim test (affected mouse). (D) Unaffected control.

A histological analysis of inner ear morphology revealed the complete lack of otoconia in both the utricle and saccule of affected mice in all embryonic stages examined, starting at embryonic day 14 (E14), as well as in inner ears of newborn and adult mice (Fig. 2). In heterozygotes, the number and structure of otoconia appear to be normal. Besides the lack of the otoconia, the morphology of all other structures of the inner ear, including the sensory epithelium, is not altered in homozygous mutant mice. Because mammals use otoconia to sense their orientation in space and to monitor posture and movements, the behavior and motor coordination deficits of the three lines can be conclusively explained by the lack of otoconia.

View larger version (89K): [in this window] [in a new window]   Figure 2. (A–D) Kossa-staining of inner ear transversal sections. The utricle (U) and saccule (S) of +/+ animals (A,C) contain dark stained, Kossa-positive otoconia, which are absent in Nox3–/Nox3– mutant animals (B,D). (E–H) SEM view of transversely cut inner ear. The otoconia of the utricle (U) and saccule (S) are present in +/+ animals only (indicated by asterisks in E, labeled OC in G). In contrast, Nox3–/Nox3– mutant animals (F,H) are devoid of otoconia. Bars: A,B,E,F, 100 µm; C,D,G,H, 10 µm.

Head-tilt was previously mapped on Chr 17 to cM position 4.1. To fine-map the mutation in line het^R96, homozygous animals (strain C3HeB/FeJ) were outcrossed to C57BL/6J. The resulting F1 hybrids were intercrossed to produce a total of 375 F2 offspring, 26% of which exhibited the het phenotype. Analysis of recombinant animals with microsatellite markers localized het^R96 to a critical interval between D17Ing4 and the centromere. Phenotypically positive F2 offspring from an outcross of line het^R542 were used to map the critical interval to an overlapping region on Chr 17 defined by the centromere and the marker D17Ing9. In a parallel approach, the classical het mutation was mapped using an overlapping series of Chr 17 deletions (You et al. 1997; Bergstrom et al. 1998, 2003) to a smaller interval between D17Brg18 and D17Brg198 on mouse Chr 17.

To narrow the region even further, a BAC clone (RP23-27N1) from the region (Fig. 3A), was retrofitted with neomycin and used to transfect embryonic stem (ES) cells. Transferring the BAC transgene onto the het/het background demonstrated that the transgene was capable of fully rescuing the mutant phenotype (Fig. 3B–D), thus limiting the critical region to the region spanned by the BAC.

View larger version (45K): [in this window] [in a new window]   Figure 3. BAC transgenic rescue of the Nox3 mutant phenotype. (A, top) Proximal Chr 17 showing the relative positions of significant SSLP markers, the het-critical region, and the rescuing BAC RP23-27N1. (Bottom) Enlarged view of RP23-27N1 showing the relative positions of candidate genes Racgef1, Tiam2, and Cldn20 and the causative gene Nox3. (B) Inner ear explant from a wild-type C57BL/6J mouse showing normal otoconia. (C) Inner ear explant from a C57BL/6J-het/het mouse showing complete absence of otoconia. (D) Inner ear explant from a het/het; TgN(RP23-27N1)/+ mouse showing complete rescue/restoration of otoconia.

In line het^R96, we identified a nonsense mutation at nucleotide position 441 (TAT TAA), encoding a premature translational stop. The predicted truncated protein consists of only three transmembrane domains and lacks most of the functionally relevant features of NADPH oxidases, including the binding sites for NADPH and FAD, two of the four histidine residues presumably involved in heme binding, as well as the entire catalytic domain (Fig. 4). For Nox2 (also known as gp91^phox) and Nox5, two proteins closely related to Nox3, a proton channel function has been reported (Banfi et al. 2001; Henderson 2001). With only three transmembrane domains remaining, a similar function for the truncated Nox3 of het^R96 can be excluded. We conclude that the Nox3 allele of het^R96 is a true functional null allele.

View larger version (18K): [in this window] [in a new window]   Figure 4. Genomic and amino acid structure of Nox3. The top portion of the figure shows the intron/exon structure of Nox3; the lower left portion shows the protein structure (model according to Wallach and Segal 1997). The location and nature of the R96, R542, het, and het2J mutations are also shown.

Using RT–PCR we were able to detect transcripts of the Nox3 gene in mouse embryonic tissue as early as E10 and persisting until birth (Fig. 5). Nox3 expression was also detected by RT–PCR analysis of mouse adult inner ear explants (Fig. 5). We could not identify mouse Nox3 transcripts by Northern blot, multiple tissue RNA dot blot, or RNA in situ hybridization, nor could we identify Nox3 protein by Western blot or immunohistochemistry, most likely due to the low level of expression. Thus, the expression of Nox3 in mouse resembles the results found for the human NOX3 that has been reported to be restricted almost exclusively to embryonic tissues. As in mice, expression levels in humans are too low to be detected by Northern blotting (Cheng et al. 2001).

View larger version (55K): [in this window] [in a new window]   Figure 5. RT–PCR analysis of Nox3 in different stages of mouse development. (A) Embryo. Nox3 is already present by E12 and persists throughout development. (M) 100-bp marker; (1) E13.5 embryo head; (2) E13.5 without head; (3) E18.5 head; (4) E10–E12 pooled; (C) no template control. (B) Adult ear. Nox3 is also present in adult ear preparations. (M) 100-bp marker; (1) adult ear; (C) no template control.

In mammals, otoconia consist of proteins and calcium carbonate in a calcite lattice. Despite intensive study, the mechanism of otoconia formation is still a matter of debate. In a recent model, the major protein of otoconia, termed otoconin 90, is secreted from the supporting cells of the nonsensory epithelium into the endolymphatic compartments whereas supporting cells of the sensory epithelium secrete numerous small vesicles ("globular substance") with a high concentration of Ca²⁺ (Thalmann et al. 2001). Although otoconin 90 and otopetrin 1, another protein recently identified to be essential for otoconia formation (Hurle et al. 2003), and the globular substance are found in the HCO₃^– enriched environment of the endolymph, the process of otoconia formation remains obscure. Interestingly, otoconin 90 has two PLA₂ (phospholipase A)-like domains with a very low pI (3.9 and 4.9), containing more than 20 Cys residues (Wang et al. 1998). In a hypothetical model, otoconin binds to the phospholipids of the globular substance vesicle membrane and undergoes a conformational change triggered by ROS produced by Nox3 located in the plasma membrane of the vesicles. This conformational change paves way for the nucleation of calcite crystal formation from the calcium provided by the vesicles and the hydrocarbonate ions of the endolymph.

	Materials and methods

Top Abstract Results and Discussion Materials and methods Acknowledgments References

 

Audiometry

The hearing ability of het^R96 and het^R542 animals was tested using a startle reflex system (SR-LAB, San Diego Instruments). The mice were placed in the testing chambers with a background noise level of 70 dB. After an acclimation period of 5 min they were exposed to 60 msec white noise stimuli of 80, 90, 100, 110 and 120 dB. Each stimulus was applied 10 times with randomly placed intermissions of 5–10 sec between each stimulus. The maximum startle response during a 100 msec time frame starting with onset of each single noise stimulus was measured, and averages of the 10 stimuli with same loudness were calculated. The hearing ability of het^2J and het^3J mice was tested by startle response to a 100-dB (18.8 kHZ) sound box. het mice are known to have normal hearing (Jones et al. 1999).

Histology

Inner ears were obtained from fetal (E 14/16/18) and newborn +/+, +/Nox3^–, and Nox3^–/Nox3^– mice, fixed in 4% PBS-buffered formalin, and embedded in paraffin without decalcification. After sectioning, coronal sections of both inner ears were stained with 5% silver nitrate for 30 min under strong light exposure (von Kossa), fixed with 5% sodium thiosulfate for 2 min, and counterstained with nuclear fast red for 3 min.

Scanning electron microscopy (SEM)

For SEM examinations the truncated tissue blocks were deparaffinized in xylene. In a graded series of ethanol the samples were dehydrated, critical-point-dried from CO₂, and sputter-coated (K575 EMITECH LTD) with 1–3-nm platinum. Coated specimens were examined in a field emission scanning electron microscope (Jeol JSM-6300F) with accelerating voltages of 5–10 kV in secondary electron mode and analyzed by an energy dispersive X-ray micro-analyzer (Link-Oxford eXL).

Positional cloning

In F2 outcross progeny, allele frequencies of C3H versus C57BL/6J are expected to be of ratio 1:1. For a marker linked to the recessive mutation, the ratio of C3H to C57BL/6J alleles is expected to increase clearly above 1. Based on this approach, we tested pooled genomic DNA from 20 affected mice on a mouse genome-wide SNP panel containing 90 polymorph markers between C3HeB/FeJ and C57BL/6J strains. This analysis resulted in linking the mutation of het^R96 to the Tcp10c gene marker and the Tap1 gene marker located in the first 18 cM of Chr 17. The result was further confirmed by a detailed haplotype analysis of all affected and nonaffected animals genotyped with the same flanking markers. To further refine the map location and narrow down the candidate region, the genomic DNA of the F2 progeny was genotyped with a series of in-house established SSLP markers covering the full candidate region and separated from each other by 0.3 Mb. Using this approach, the critical interval was localized distal to the centromere and proximal to SSLP marker D17Ing4 (forward PCR primer, TCCCATTTCTGATCCCTTCA; reverse PCR primer, GCAGACCGCTAGCTTAGGAA).

Similarly, the mutation in line het^R542 was mapped to an overlapping chromosomal region distal to the centromere and proximal to SSLP marker D17Ing9 (Fig. 4; forward PCR primer, AATTCACCCCACAAA TCCTG; reverse PCR primer, GCAGTGGTCATTGTGACAGC).

In our deletion mapping strategy, C57BL/6J-het/het mice were mated to a series of regional Chr 17 deletions (Bergstrom et al. 2003). Deletions D17Aus9^df-2J, D17Aus9^df-4J, D17Aus9^df-7J, D17Aus9^df-10J, D17Aus9^df-12J, D17Aus9^df-13J, D17Aus9^df-18J, D17Aus9^df-25J, D17Aus9^df-27J, D17Aus9^df-33J, T^22H, and T^33H failed to complement het. The het locus was complemented by D17Aus9^df-11J and Sod2^df-1J. Detailed analysis of the deletion breakpoints in these lines with a series of in-house SSLP markers localized het to an interval between D17Brg18 (forward primer, GAGGTTT TTGGCTGTAAGTGC; reverse primer, TTCACAAACTACTGACACT GCAAA) and D17Brg198 (forward primer, ACAACAATGCCTGAGGT TGA; reverse primer, CAAAGTGGCTCACTCTCTGC).

BAC rescue

BAC RP23-27N1 was retrofitted with neomycin at the lox511 site using the pRetro–ES vector (Storb et al.). Following linearization with PI-SceI (New England Biolabs), the BAC was then transfected into D17Aus9^df-27J ES cells using DOTAP transfection reagent (Roche) and the protocol supplied by the manufacturer. Neomycin-resistant clones were expanded and tested for the presence of the T7 BAC end (using the T7 primer TAATACGACTCACTATAGGG and the mouse-specific primer TGGG GAATTTTTACAGAGCCTA), the SP6 BAC end (using the SP6 primer CATACGATTTAGGTGACACTATAG and the mouse-specific primer GCCAAGGTGTAACTTGTGGA), and the vector backbone (using the cat-specific primers ATCCCAATGGCATCGTAAAG and GGATTGG CTGAGACGAAAAA, and Myog-specific internal control primers TTAC GTCCATCGTGGACAGCAT and TGGGCTGGGTGTTAGTCTTAT). ES cell clones containing both ends of the BAC were microinjected into C57BL/6J blastocysts and the resulting chimeras crossed to C57BL/6J-het/het females in the hope of placing the BAC transgene (Tg) in a D17Aus9^df-27J/het null background. However, due to chance and the independent assortment of the transgene and the deletion, the first transgenic pup obtained was Tg/+; +/het. This mouse was crossed again to C57BL/6J-het/het females and genotyped with the het-flanking markers D17Brg11 (Bergstrom et al. 2003) and D17Mit170 (Dietrich et al. 1996) to identify Tg/+; het/het males. The colony is maintained by mating these males to C57BL/6J-het/het females.

RT–PCR

To amplify partial mouse Nox3 cDNA from embryos by PCR, primers nox3-m25F CTGGCCTGGGTATCTCTCTG (corresponding to nucleotides 587–606 of Nox3 cDNA), and nox3-m24R CTCAGGCAGGCTCT GTGATT (nucleotides 1359–1340) were used. The primer pair produces a PCR product of 772 bp in length spanning several exon boundaries.

PCR was performed using a "touch down" method according to the following protocol: Step 1, 94°C, 5 min; Step 2, 94°C, 30 sec; Step 3, 61°C, 30 sec; Step 4, 72°C, 80 sec; two cycles; annealing temperature 59°C for two cycles; annealing temperature 57°C for two cycles; annealing temperature 55°C for 28 cycles; final extension: 10 min 72°C. PCR products were purified and sequenced.

To amplify partial mouse Nox3 cDNA from adult inner ear preparations, primers mCG7406-37F GGCTCCCAGTGAGCTCTGTA (corresponding to nucleotides 1176–1195 of Nox3 cDNA) and mCG7406–330R TGAGCCTTCCCTTGTTCACT (nucleotides 1469–1449) were used. The primer pair produces a PCR product of 294 bp in length spanning several exon boundaries. PCR was performed according to the following protocol: Step 1, 95°C, 120 sec; Step 2, 95°C, 45 sec; Step 3, 60°C, 45 sec; (repeating Steps 2 and 3 for 35 cycles); final extension, 7 min 72°C.

	Acknowledgments

Top Abstract Results and Discussion Materials and methods Acknowledgments References

 
We thank the technical staff of the Ingenium R&D Group, the Ingenium Neurobiology and Pathology Group, and the Scientific Services of The Jackson Laboratory. We thank Anneliese Wunderlich, Florian Boehme, Markus Völkel, and Stephanie Kohlmann for excellent technical assistance; and Andreas Popp and Jürgen Schlegel for histopathological analysis.

This manuscript is dedicated in memory of Rebecca Bergstrom, a co-author of this work, who passed away February 6, 2004, after a lengthy battle with breast cancer. She was with us all too briefly and will be dearly missed. "Such courage, strength, and grace from such a gentle soul."

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.

	Footnotes

 
Article published online ahead of print. Article and publication date are at http://www.genesdev.org/cgi/doi/10.1101/gad.1172504.

⁵ Corresponding author.

E-MAIL deb{at}jax.org; FAX (207) 288-6078.

	References

Top Abstract Results and Discussion Materials and methods Acknowledgments References

 
Banfi, B., Molnar, G., Maturana, A., Steger, K., Hegedus, B., Demaurex, N., and Krause, K.H. 2001. A Ca(2+)-activated NADPH oxidase in testis, spleen, and lymph nodes. J. Biol. Chem. 276: 37594–37601.[Abstract/Free Full Text]

Bergstrom, R.A., You, Y., Erway, L.C., Lyon, M.F., and Schimenti, J.C. 1998. Deletion mapping of the head tilt (het) gene in mice: A vestibular mutation causing specific absence of otoliths. Genetics 150: 815–822.[Abstract/Free Full Text]

Bergstrom, D.E., Bergstrom, R.A., Munroe, R.J., Lee, B.K., Browning, V.L., You, Y., Eicher, E.M., and Schimenti, J.C. 2003. Overlapping deletions spanning the proximal two-thirds of the mouse t complex. Mamm. Genome 14: 817–829.[Medline]

Cheng, G., Cao, Z., Xu, X., van Meir, E.G., and Lambeth, J.D. 2001. Homologs of gp91phox: Cloning and tissue expression of Nox3, Nox4, and Nox5. Gene 269: 131–140.[CrossRef][Medline]

Cohen-Salmon, M., El-Amraoui, A., Leibovici, M., and Petit, C. 1997. Otogelin: A glycoprotein specific to the acellular membranes of the inner ear. Proc. Natl. Acad. Sci. 94: 14450–14455.[Abstract/Free Full Text]

Cook, S. 1999. The Jackson Laboratory mouse mutant resource 1999 mutation reports. In Mouse genome informatics direct data submission. http://www.informatics.jax.org/searches/reference.cgi?57655

Dietrich, W.F., Miller, J., Steen, R., Merchant, M.A., Damron-Boles, D., Husain, Z., Dredge, R., Daly, M.J., Ingalls, K.A., O'Conner, T.J., et al. 1996. A comprehensive genetic map of the mouse genome. Nature 380: 149–152.[CrossRef][Medline]

El-Amraoui, A., Cohen-Salmon, M., Petit, C., and Simmler, M.C. 2001. Spatiotemporal expression of otogelin in the developing and adult mouse inner ear. Hear. Res. 158: 151–159.[CrossRef][Medline]

Henderson, L.M. 2001. NADPH oxidase subunit gp91phox: A proton pathway. Protoplasma 217: 37–42.[CrossRef][Medline]

Hurle, B., Lane, K., Kenney, J., Tarantino, L.M., Bucan, M., Brownstein, B.H., and Ornitz, D.M. 2001. Physical mapping of the mouse tilted locus identifies an association between human deafness loci DFNA6/14 and vestibular system development. Genomics 77: 189–199.[CrossRef][Medline]

Hurle, B., Ignatova, E., Massironi, S.M., Mashimo, T., Rios, X., Thalmann, I., Thalmann, R., and Ornitz, D.M. 2003. Nonsyndromic vestibular disorder with otoconial agenesis in tilted/mergulhador mice caused by mutations in otopetrin 1. Hum. Mol. Genet. 12: 777–789.[Abstract/Free Full Text]

Jones, S.M., Erway, L.C., Bergstrom, R.A., Schimenti, J.C., and Jones, T.A. 1999. Vestibular responses to linear acceleration are absent in otoconia-deficient C57BL/6JEi-het mice. Hear. Res. 135: 56–60.[CrossRef][Medline]

Kelly, E.M. and Hartman. 1958. Tilted head, th. Mouse News Letter 19: 37.

Kikuchi, H., Hikage, M., Miyashita, H., and Fukumoto, M. 2000. NADPH oxidase subunit, gp91(phox) homologue, preferentially expressed in human colon epithelial cells. Gene 254: 237–243.[CrossRef][Medline]

Lambeth, J.D. 2002. Nox/Duox family of nicotinamide adenine dinucleotide (phosphate) oxidases. Curr. Opin. Hematol. 9: 11–17.[CrossRef][Medline]

Lalonde, R. and Strazielle, C. 1999. Motor performance of spontaneous murine mutations with cerebellar atrophy. In: Handbook of molecular-genetic techniques for brain and behaviour research (eds. W.E. Crusio and R.T. Gerlai), pp. 627–637. Elsevier, Amsterdam.

Meng, T.C., Fukada, T., and Tonks, N.K. 2002. Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol. Cell 9: 387–399.[CrossRef][Medline]

Munroe, R.J., Bergstrom, R.A., Zheng, Q.Y., Libby, B., Smith, R., John, S.W., Schimenti, K.J., Browning, V.L., and Schimenti, J.C. 2000. Mouse mutants from chemically mutagenized embryonic stem cells. Nat. Genet. 24: 318–321.[CrossRef][Medline]

Ornitz, D.M., Bohne, B.A., Thalmann, I., Harding, G.W., and Thalmann, R. 1998. Otoconial agenesis in tilted mutant mice. Hear. Res. 122: 60–70.[CrossRef][Medline]

Porsolt, R.D. 1979. Animal model of depression. Biomedicine 30: 139–140.[Medline]

Russ, A., Stumm, G., Augustin, M., Sedlmeier, R., Wattler, S., and Nehls, M. 2002. Random mutagenesis in the mouse as a tool in drug discovery. Drug Discov. Today 7: 1175–1183.[CrossRef][Medline]

Stumm, G., Russ, A., and Nehls, M. 2002. Deductive genomics: A functional approach to identify innovative drug targets in the postgenome era. Am. J. Pharmacogenomics 2: 263–271.[Medline]

Sweet, H. 1980. Head tilt. Mouse News Letter 63: 19.

Thalmann, R., Ignatova, E., Kachar, B., Ornitz, D.M., and Thalmann, I. 2001. Development and maintenance of otoconia: Biochemical considerations. Ann. NY Acad. Sci. 942: 162–178.[Abstract/Free Full Text]

Wallach, T.M. and Segal, A.W. 1997. Analysis of glycosylation sites on gp91phox, the flavocytochrome of the NADPH oxidase, by site-directed mutagenesis and translation in vitro. Biochem. J. 321: 583–585.

Wang, Y., Kowalski, P.E., Thalmann, I., Ornitz, D.M., Mager, D.L., and Thalmann, R. 1998. Otoconin-90, the mammalian otoconial matrix protein, contains two domains of homology to secretory phospholipase A2. Proc. Natl. Acad. Sci. 95: 15345–15350.[Abstract/Free Full Text]

Wang, Y., Thalmann, I., Thalmann, R., and Ornitz, D.M. 1999. Mapping the mouse otoconin-90 (Oc90) gene to chromosome 15. Genomics 58: 214–215.[Medline]

Ying, H.C., Hurle, B., Wang, Y., Bohne, B.A., Wuerffel, M.K., and Ornitz, D.M. 1999. High-resolution mapping of tlt, a mouse mutant lacking otoconia. Mamm. Genome 10: 544–548.[CrossRef][Medline]

You, Y., Bergstrom, R., Klemm, M., Lederman, B., Nelson, H., Ticknor, C., Jaenisch, R., and Schimenti, J. 1997. Chromosomal deletion complexes in mice by radiation of embryonic stem cells. Nat. Genet. 15: 285–288.[CrossRef][Medline]

Zwaenepoel, I., Mustapha, M., Leibovici, M., Verpy, E., Goodyear, R., Liu, X.Z., Nouaille, S., Nance, W.E., Kanaan, M., Avraham, K.B., et al. 2002. Otoancorin, an inner ear protein restricted to the interface between the apical surface of sensory epithelia and their overlying acellular gels, is defective in autosomal recessive deafness DFNB22. Proc. Natl. Acad. Sci. 99: 6240–6245.[Abstract/Free Full Text]

CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				W. M. Nauseef Biological Roles for the NOX Family NADPH Oxidases J. Biol. Chem., June 20, 2008; 283(25): 16961 - 16965. [Full Text] [PDF]

				H. Sumimoto, S. Kamakura, and T. Ito Structure and Function of the PB1 Domain, a Protein Interaction Module Conserved in Animals, Fungi, Amoebas, and Plants Sci. Signal., August 28, 2007; 2007(401): re6 - re6. [Abstract] [Full Text] [PDF]

				A. Orient, A. Donko, A. Szabo, T. L. Leto, and M. Geiszt Novel sources of reactive oxygen species in the human body Nephrol. Dial. Transplant., May 1, 2007; 22(5): 1281 - 1288. [Full Text] [PDF]

				D. R. Herr, N. Grillet, M. Schwander, R. Rivera, U. Muller, and J. Chun Sphingosine 1-Phosphate (S1P) Signaling Is Required for Maintenance of Hair Cells Mainly via Activation of S1P2 J. Neurosci., February 7, 2007; 27(6): 1474 - 1478. [Abstract] [Full Text] [PDF]

				K. Bedard and K.-H. Krause The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology Physiol Rev, January 1, 2007; 87(1): 245 - 313. [Abstract] [Full Text] [PDF]

				M. Geiszt NADPH oxidases: New kids on the block Cardiovasc Res, July 15, 2006; 71(2): 289 - 299. [Abstract] [Full Text] [PDF]

				B. Cohen Inner ear troubles: the roar in the forest? FASEB J, May 1, 2006; 20(7): 806 - 808. [Full Text] [PDF]

				P. L. Hordijk Regulation of NADPH Oxidases: The Role of Rac Proteins Circ. Res., March 3, 2006; 98(4): 453 - 462. [Abstract] [Full Text] [PDF]

				T. Ueyama, M. Geiszt, and T. L. Leto Involvement of rac1 in activation of multicomponent nox1- and nox3-based NADPH oxidases. Mol. Cell. Biol., March 1, 2006; 26(6): 2160 - 2174. [Abstract] [Full Text] [PDF]

				J. Kuroda, K. Nakagawa, T. Yamasaki, K.-i. Nakamura, R. Takeya, F. Kuribayashi, S. Imajoh-Ohmi, K. Igarashi, Y. Shibata, K. Sueishi, et al. The superoxide-producing NAD(P)H oxidase Nox4 in the nucleus of human vascular endothelial cells Genes Cells, December 1, 2005; 10(12): 1139 - 1151. [Abstract] [Full Text] [PDF]

				T. Kawahara, D. Ritsick, G. Cheng, and J. D. Lambeth Point Mutations in the Proline-rich Region of p22phox Are Dominant Inhibitors of Nox1- and Nox2-dependent Reactive Oxygen Generation J. Biol. Chem., September 9, 2005; 280(36): 31859 - 31869. [Abstract] [Full Text] [PDF]

				N. Ueno, R. Takeya, K. Miyano, H. Kikuchi, and H. Sumimoto The NADPH Oxidase Nox3 Constitutively Produces Superoxide in a p22phox-dependent Manner: ITS REGULATION BY OXIDASE ORGANIZERS AND ACTIVATORS J. Biol. Chem., June 17, 2005; 280(24): 23328 - 23339. [Abstract] [Full Text] [PDF]

				R. P. Brandes and J. Kreuzer Vascular NADPH oxidases: molecular mechanisms of activation Cardiovasc Res, January 1, 2005; 65(1): 16 - 27. [Abstract] [Full Text] [PDF]

				M. Geiszt and T. L. Leto The Nox Family of NAD(P)H Oxidases: Host Defense and Beyond J. Biol. Chem., December 10, 2004; 279(50): 51715 - 51718. [Full Text] [PDF]

				B. Banfi, B. Malgrange, J. Knisz, K. Steger, M. Dubois-Dauphin, and K.-H. Krause NOX3, a Superoxide-generating NADPH Oxidase of the Inner Ear J. Biol. Chem., October 29, 2004; 279(44): 46065 - 46072. [Abstract] [Full Text] [PDF]

				M. T. Quinn and K. A. Gauss Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases J. Leukoc. Biol., October 1, 2004; 76(4): 760 - 781. [Abstract] [Full Text] [PDF]

				G. Cheng, D. Ritsick, and J. D. Lambeth Nox3 Regulation by NOXO1, p47phox, and p67phox J. Biol. Chem., August 13, 2004; 279(33): 34250 - 34255. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 1172504v1 18/5/486    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Paffenholz, R. Articles by Bergstrom, D. E. Search for Related Content PubMed PubMed Citation Articles by Paffenholz, R. Articles by Bergstrom, D. E. Social Bookmarking                   What's this?