|
|
|
Research Institute of Molecular Pathology (IMP), A-1030 Vienna, Austria
| Abstract |
|---|
|
|
|---|
li*) display impaired liver regeneration after partial hepatectomy (PH). This phenotype correlates with increased protein levels of the cdk-inhibitor p21 in the liver. We performed PH experiments in several double-knockout mouse models to genetically identify the signaling events regulated by c-Jun. Inactivation of p53 in c-jun
li* mice abrogated both hepatocyte cell cycle block and increased p21 protein expression. Consistently, liver regeneration was rescued in c-jun
li* p21 / double-mutant mice. This indicated that c-Jun controls hepatocyte proliferation by a p53/p21-dependent mechanism. Analyses of p21 mRNA and protein expression in livers of c-jun
li* mice after PH revealed that the accumulation of p21 protein is due to a post-transcriptional/post-translational mechanism. We have investigated several candidate pathways implicated in the regulation of p21 expression, and observed increased activity of the stress kinase p38 in regenerating livers of c-jun
li* mice. Importantly, conditional deletion of p38
in livers of c-jun
li* mice fully restored hepatocyte proliferation and attenuated increased p21 protein levels after PH. These data demonstrate that c-Jun/AP-1 regulates liver regeneration through a novel molecular pathway that involves p53, p21, and the stress kinase p38
.
[Keywords: c-Jun; p53; p21; p38/liver regeneration; partial hepatectomy]
Received April 12, 2006; revised version accepted June 1, 2006.
(TNF
) and Interleukin-6 (IL-6) (Akerman et al. 1992
B (NF-
B), signal transducer and activator of transcription 3 (STAT3), CCAAT enhancer-binding protein
(C/EBP
), and activator protein 1 (AP-1) (Cressman et al. 1995
(TGF
), and heparin-binding epidermal growth factor (HB-EGF) stimulate S-phase entry of hepatocytes (Mead and Fausto 1989
In response to PH, the DNA-binding activity of the dimeric transcription factor AP-1, composed of the products of the Jun and Fos families of genes, is rapidly induced (Heim et al. 1997
). Several reports have demonstrated the requirement for c-Jun in hepatocyte survival and proliferation. Mice lacking c-jun die at mid-gestation and their embryonic lethality is associated with increased apoptosis in fetal liver cells (Hilberg et al. 1993
; Johnson et al. 1993
; Eferl et al. 1999
). Consistently, an antiapoptotic function for c-Jun has also been found in preneoplastic hepatocytes during liver cancer development (Eferl et al. 2003
). In contrast, conditional inactivation of c-jun in normal hepatocytes after birth had no effect on hepatocyte survival, but negatively affected hepatocyte proliferation during liver development and in stress response after PH (Behrens et al. 2002
).
The molecular mechanism by which c-Jun controls hepatocyte proliferation in vivo is still unknown. Several reports have established a correlation between loss of c-jun and p53 activity. For example, the proliferation defect in MEFs lacking c-jun is abrogated after additional inactivation of p53 (Schreiber et al. 1999
). Moreover, it has been shown that c-Jun regulates the exit from p53-imposed growth arrest after UV treatment in MEFs by controlling the association of p53 with the p21 promoter (Shaulian et al. 2000
). In liver cancer, c-Jun seems to inhibit apoptosis of tumor cells through a p53-dependent mechanism. Tumors lacking c-jun displayed increased p53 levels and up-regulation of the proapoptotic p53 target gene noxa (Eferl et al. 2003
). We therefore asked whether c-Jun controls hepatocyte proliferation in vivo via a p53-dependent molecular mechanism. For this purpose we used PH in double-knockout mouse models as an experimental system.
As shown previously, conditional inactivation of c-jun in the liver by employing either constitutively active, hepatocyte-specific Alb-cre line (c-jun
li) or an inducible Mx-cre line deleting in hepatocytes and hematopoietic cells (c-jun
li*) caused a severe liver regeneration defect (Behrens et al. 2002
). At the molecular level, impaired hepatocyte proliferation correlated with increased protein levels of p21, a p53-dependent inhibitor of cyclin-dependent kinases. Here we show that impaired liver regeneration of c-jun
li* mice is completely rescued in a p53 or p21-negative genetic background. We demonstrate that the increase in p21 protein levels in c-jun deficient livers is p53-dependent and sufficient to block hepatocyte proliferation. Furthermore, we show that the up-regulation of p21 protein is not caused by a direct transcriptional activation of the p21 promoter by p53, since no alterations in p21 mRNA expression were found after PH in c-jun
li* mice. Intriguingly, up-regulation of p21 protein in regenerating livers of c-jun
li* mice correlated with increased phosphorylation of p38, a stress kinase that is known to stabilize p21. The aberrant activity of p38 was abolished by loss of p53 or p21, suggesting a signaling cross-talk between these proteins. p38 stress kinase is most likely responsible for increased p21 levels and impaired liver regeneration in c-jun
li* mice, since combined conditional deletion of c-jun and p38
in the liver abrogated both elevated expression of p21 protein and impaired hepatocyte proliferation in vivo.
| Results |
|---|
|
|
|---|
li* mice and restores hepatocyte proliferation after PH
We have addressed the question whether p53 is responsible for impaired liver regeneration in c-jun
li* miceafter PH. For that purpose we used mice harboring floxed alleles of c-jun (c-jun f/f mice) (Behrens et al. 2002
) and the inducible Mx-cre transgene (Kuhn et al. 1995
), and crossed them with p53-deficient mice (p53 / mice) (Donehower et al. 1992
) to obtain c-jun
li* p53 / double-mutant mice. Since both Alb-cre and Mx-cre combined with the conditional c-jun allele have previously been shown to lead to the same impaired liver regeneration phenotype (Behrens et al. 2002
), we used in this study only the Mx promoter-controlled cre expression, which was induced by injection of poly I/C. The efficiency of c-jun deletion in the liver was confirmed by Southern blotting (Fig. 1A) and the lack of c-jun expression in mutant mice after PH was confirmed by RNase protection assay and Western blotting (Fig. 1B,C). Germline inactivation of p53 was analyzed by PCR (Fig. 1D). c-jun
li* p53 / and corresponding control mice (c-jun
li*, p53 /, c-jun f/f) did not show any overt phenotype after poly I/C injection (data not shown). All these mice were subjected to PH in order to trigger liver regeneration. As previously shown, 50% of the c-jun
li* mice died 24 d after PH due to impaired liver regeneration (Behrens et al. 2002
). In contrast, c-jun
li* p53 / mice displayed mortality rates that were similar to controls, indicating a rescue of the liver regeneration defect in the absence of p53 (Fig. 1E).
|
li* mice at the 48-h time point after PH (Fig. 2A). Moreover, a quantitative time course of Ki67 staining revealed a marked delay of c-jun-deficient hepatocytes in reentering the cell cycle after the surgery (Fig. 2B). To confirm these results, we measured DNA replication by BrdU incorporation. Consistently, almost no hepatocytes were able to enter S phase in c-jun
li* mice 48 h after PH (Fig. 2C). In contrast, cell cycle progression determined by Ki67 staining and BrdU incorporation was completely restored in c-jun
li* p53 / double-mutant mice (Fig. 2A,C). Deletion of p53 alone had no overt effect on hepatocyte proliferation, since the proliferation rate was comparable to c-jun f/f control livers (Fig. 2A). These data suggest that impaired liver regeneration in c-jun
li* mice is due to a cell cycle block imposed by p53 activity.
|
li* mice correlates with a p53-dependent increase in p21 protein levels
To investigate potential downstream target genes of c-Jun and p53 in liver regeneration, we have first analyzed the expression of G1, G1/S, and G2 cyclins in liver samples from mice at various time points after the surgery. mRNA expression of different cyclins occurred with similar kinetics after PH irrespective of the mouse genotype (Supplementary Fig. 1). Cyclin D1 showed a biphasic kinetic with two peaks of expression at 12 and 48 h after PH (Supplementary Fig. 1), and was slightly elevated in livers of c-jun
li* mice, which is in agreement with previously published data (Behrens et al. 2002
). The other cyclins peaked at 48 h after PH even in regeneration-defective livers lacking c-jun (Supplementary Fig. 1). Overall, we did not observe any major transcriptional alterations of cell cycle regulators in regenerating c-jun-defcient livers after PH. Therefore, we next analyzed protein levels for cyclins and other cell cycle regulators including the p53-regulated cyclin-dependent kinase inhibitor p21. Interestingly, protein expression of cyclin D1 was found to be highly expressed at 12 and 24 h after PH in c-jun
li* mice, but strongly reduced at the 48-h time point when compared with wild-type mice (Fig. 3). Moreover, cyclin A was inefficiently induced at the 48-h time point in livers lacking c-jun. In contrast, levels of cyclin E were strongly elevated 48 h after PH (Fig. 3), presumably due to accumulation at the G1 restriction point and subsequent failure to enter S phase. Importantly, the reduction in cyclin D1 and cyclin A protein levels as well as the elevation of cyclin E protein levels at the 48-h time point were rescued in c-jun
li* p53 / livers (Fig. 3). Furthermore, reduced protein levels of the cell cycle regulator PCNA were found in c-jun
li* mice 48 h after PH, but not in c-jun
li* p53 / double-mutant livers (Fig. 3). We also observed reduced expression of retinoblastoma protein (RB) in c-jun
li* at 48 h and 72 h after PH, and phosphorylated RB was not detectable at all at the 72-h time point (data not shown). However, RB was expressed at similar levels in control and c-jun
li* p53 / double-mutant livers, and phosphorylated RB was readily detectable 72 h after PH (data not shown). Most importantly, p21 protein levels were rapidly induced in c-jun
li*mice as early as 6 h after PH and remained elevated until 24 h after PH. However, this induction was abolished in double-mutant livers (Fig. 3), suggesting that the increase in p21 protein levels in c-jun
li* mice is due to a p53-dependent mechanism.
|
li* mice
To test whether impaired liver regeneration in c-jun
li* mice is caused by a p53-dependent up-regulation of p21 protein expression, we have generated c-jun
li* p21 / double-mutant mice and subjected them to PH. Importantly, morbidity and premature lethality of c-jun
li* mice after PH was rescued in c-jun
li* p21 / double-mutant mice (data not shown). Moreover, immunohisto-chemical analysis of Ki67 expression in regenerating livers revealed that loss of p21 fully rescued proliferation of c-jun
li* hepatocytes. Ki67 expression peaked 48 h after PH in wild-type, p21 / and c-jun
li* p21 / double-knockout livers, but not in c-jun-deficient livers (Fig. 4A,B). Proliferation of hepatocytes lacking p21 alone seemed accelerated when compared with wild-type controls, since p21 / livers showed slightly higher numbers of Ki67-positive hepatocytes at the 48-h time point after PH (Fig. 4B). This observation is in agreement with published data showing that p21 / hepatocytes display higher rate of progression through the G1 phase of the cell cycle after PH (Albrecht et al. 1998
). Furthermore, livers lacking p21 alone and c-jun
li* p21/ double-knockout livers exhibited higher rates of BrdU incorporation 3248 h after PH when compared with wild-type controls (data not shown). In contrast, hardly any staining was detected at these time points in mutant c-jun
li* livers (data not shown), confirming that hepatocyte S-phase entry is impaired in the absence of c-Jun. Moreover, 10 d after PH, double mutants restored liver mass as efficiently as wild-type littermates or control p21 /mice (data not shown). These results suggest that increased p21 protein expression is responsible for the delayed G1S transition of hepatocytes and for impaired liver regeneration in c-jun
li* mice.
|
li* mice by a post-transcriptional/post-translational mechanism
At least two principal mechanisms can lead to elevated p21 protein levels in mutant mice: Lack of c-Jun results in increased transcriptional activity of the p53 protein, thereby enhancing p21 mRNA expression, or alternatively, p21 protein levels are regulated by a c-Jun/p53-dependent post-transcriptional mechanism. To test these hypotheses, we first investigated p21 mRNA levels by Northern blotting and semiquantitative RTPCR analysis. Intriguingly, p21 mRNA expression was induced rapidly and peaked 24 h after PH (Fig. 5A,B) without significant differences between control, p53 /, c-jun
li*, and c-jun
li* p53 / mice. These results suggested that p21 mRNA induction in regenerating livers is independent of c-Jun and p53. A detailed expression analyses of other p53 target genes such as mdm2, bax, and cyclin G also revealed no significant difference between control, p53 /, c-jun
li*, and c-jun
li* p53 / mice (Fig. 5B), suggesting that the transcriptional activity of p53 is unchanged in c-jun
li* mice after PH. Furthermore, expression of p53 in the absence of c-Jun was affected neither at the RNA level (Fig. 5B) nor at the protein level (data not shown). Analysis of p53 phosphorylation at Ser 15 also revealed no changes in p53 activity in livers of c-jun
li* mice (data not shown). However, loss of p53 clearly reduced p21 protein levels in regenerating livers of c-jun
li* mice (Fig. 3). Overall, these data suggest that the increased abundance of p21 protein in regenerating c-jun
li* livers occurs through a p53-depen-dent post-transcriptional/post-translational mechanism.
|
li* mice display increased activity of p38 stress kinase after PH
The regulation of p21 protein expression and stability is rather complex, and many factors are involved. We have studied the expression of several candidate genes implicated in the regulation of p21 protein levels in the context of liver regeneration, including C/EBP
and TGF
. We did not find any major changes in the expression pattern of C/EBP
and TGF
, either at the mRNA level or at the protein level (Supplementary Fig. 2; data not shown). Moreover, several kinases like JNK, AKT/PKB, ERK, and p38 MAPK (mitogen-activated protein kinase) have been demonstrated to play important roles in regulating p21 protein expression and stability (Kobayashi and Tsukamoto 2001
; Kim et al. 2002
; Li et al. 2002
). We have found no significant alterations in the expression of phospho-ERK1/2 (Supplementary Fig. 2; data not shown). In contrast, phosphorylation of p38 MAPK was found to be consistently up-regulated in livers of c-jun-deficient mice at 6, 12, 24, and 48 h after PH, and correlated with elevated p21 protein expression (Fig. 6A,B; data not shown). These findings suggested that increased activity of p38 MAPK might be responsible for aberrant p21 protein expression in regenerating livers lacking c-Jun. Induction of p38 activity in wild-type livers occurred only at the 12-h time point and correlated with induction of p21 (Fig. 6B; data not shown). Most importantly, increased phosphorylation of p38 MAPK was abolished in c-jun
li* p53 / and c-jun
li* p21 / double-mutant mice (Fig. 6A,B) implying that both p21 and p53 can positively regulate p38 MAPK activity. Intriguingly, TGF
1 and MKK3/MKK6 signaling, which is known to influence the activity of p38 stress kinase, was not substantially changed in livers of c-jun
li* mice when compared with wild-type controls (Supplementary Fig. 2). These results suggest that different, c-Jun-dependent signaling pathways seem to be involved in triggering p38 activation after PH. We therefore asked whether the combined deletion of c-jun and p38
, a major isoform of p38 MAPK, has an impact on hepatocyte proliferation and p21 protein levels after PH. Interestingly, conditional loss of both genes in the liver resulted in hepatocyte proliferation comparable to littermate controls (Fig. 6C). Most importantly, deletion of both c-jun and p38
attenuated elevated p21 protein levels after PH, since the expression levels were equal in mutant and control livers (Fig. 6D). These results strongly suggest that in regenerating livers c-Jun prevents p38-mediated accumulation of p21 protein, thereby allowing hepatocyte proliferation.
|
| Discussion |
|---|
|
|
|---|
We investigated the genetic link between c-Jun and p53 in liver regeneration employing PH in c-jun
li*p53/double-mutant mice. These experiments demonstrated that impaired liver regeneration and G1/S transition of hepatocytes in c-jun
li* mice were fully rescued in a p53-negative background. Therefore, we concluded that the liver regeneration defect in the absence of c-Jun is caused by a cell cycle block imposed by p53. The most prominent p53-target gene implicated in cell cycle progression/growth arrest is the cdk inhibitor p21. Transgenic mice overexpressing p21 specifically in the liver under the control of the transthyretin (TTR) promoter showed impaired hepatocyte cell cycle progression and liver regeneration after PH (Wu et al. 1996
). In contrast, hepatocytes from livers of p21 knockout mice displayed accelerated proliferation after PH due to a higher rate of progression through the G1 phase of the cell cycle (Albrecht et al. 1998
). We have observed increased p21 protein levels in livers of c-jun
li* mice as early as 6 h after PH. Furthermore, we demonstrated in vivo that this molecular event is sufficient to cause impaired liver regeneration in c-jun
li* mice, since hepatocyte proliferation was completely rescued in c-jun
li* p21 / double-mutant mice. It is worth mentioning that germline deletion of neither p53 nor p21 was able to rescue the lethality of c-jun knockout embryos (Schreiber et al. 1999
; Passegue et al. 2002
) implying that the events controlled by c-Jun in developmental processes and in hepatocyte proliferation after PH seem to be fundamentally different.
Our results indicated that liver regeneration is impaired in c-jun
li* mice due to a cell cycle block imposed by a p53-dependent up-regulation of p21. Since it has been shown that c-Jun negatively regulates p53 association with the p21 promoter (Shaulian et al. 2000
), we assumed that increased abundance of p21 protein in the livers of c-jun
li* mice might be caused by a p53-dependent effect on p21 mRNA transcription. Intriguingly, analysis of p21 mRNA expression in livers after PH showed that the increase in p21 protein levels in livers of c-jun
li* mice was apparently not due to a transcriptional effect of p53. The induction of p21 mRNA was comparable in livers of control, p53/, c-jun
li*, and c-jun
li* p53 / mice. These data demonstrated that neither c-jun nor p53 contributed to p21 mRNA expression in the liver after PH. Our results are in agreement with published data which demonstrated that the induction of hepatic p21 mRNA after PH is independent of p53 (Albrecht et al. 1997
). Besides p21, the expression of several other p53 target genes was found unchanged in c-jun
li* mice. p53 expression and transcriptional activity was not altered in c-jun
li* mice; therefore we concluded that increased expression/stability of p21 protein was caused by a post-transcriptional/post-translational, p53-mediated mechanism.
Stability of the p21 protein is largely dependent on the proteasome degradation pathway, which is regulated by interaction with several other proteins such as MDM2, WISp39, and IFI16 (Kwak et al. 2003
; Zhang et al. 2004
; Jascur et al. 2005
). In addition, C/EBP
was shown to block proteolytic degradation of p21 by direct protein protein interaction in livers of newborn mice (Timchenko et al. 1997
). However, expression of mdm2 and C/EBP
mRNAs was not changed in c-jun
li* mice after PH (data not shown). Expression and stability of p21 protein may also be influenced by phosphorylation through several kinases such as p38 MAPK, JNK1, and AKT/PKB (Kim et al. 2002
; Li et al. 2002
). Recently, high activities of p38
and JNKs were detected in primary hepatocytes lacking c-Jun (Eferl et al. 2003
), suggesting a role of stress kinases in the expression of p21 protein. We have found high activity of p38 MAPK in livers c-jun
li* mice at various time points following PH. This correlated with impaired hepatocyte proliferation and elevated expression of p21 protein. Importantly, increased phosphorylation of p38 kinase was abolished in c-jun
li* p53 / and c-jun
li* p21 / double-mutant mice, implying that both p53 and p21 can activate p38 by a post-transcriptional mechanism.
To gain further insights into the mechanism by which increased p38 activity affected hepatocyte proliferation in c-jun-deficient livers, we performed PH in c-jun
li* p38
li* mice. Double-mutant livers showed similar rates of proliferating hepatocytes as wild-type controls. Most importantly, similar p21 protein levels were detected in liver extracts from double-mutant and control littermates. These results suggested that increased p38
activity is responsible for altered p21 expression and impaired liver regeneration in c-jun
li* mice.
How p38
affects p21 protein expression is presently unknown. p38 MAPK has been reported to play a key role in stabilizing p21 protein (Alderton et al. 2001
; Kim et al. 2002
). It has been demonstrated in a HD3 human colon carcinoma cell line, that stress signals initiated by TGF
lead to activation of p38
and JNK1, which in turn, phosphorylated p21 at Ser130 leading to increased stability (Kim et al. 2002
). However, we did not find any major alterations in the expression pattern of TGF
in liver extracts from c-jun
li* mice. Therefore, high activity of p38
in regenerating livers lacking c-jun appears to be independent of TGF
signaling pathway. We propose that p38
is activated by a p53-dependent pathway (Fig. 7), therefore signaling downstream of p53. Alternatively, elevated activity of p38 MAPK might be a result of increased susceptibility of c-jun
li* mice to stress caused by PH and the subsequent p21-mediated cell cycle arrest (Fig. 7).
|
has been shown to enhance p53 activity by phosphorylation, and therefore trigger apoptosis or cell cycle arrest (Bulavin et al. 1999
signaling followed by p53 phosphorylation can lead to p21 induction and cell cycle arrest (Kim et al. 2005
In summary, we have demonstrated that c-Jun/AP-1 promotes G1S transition in hepatocytes in vivo through a p53-dependent pathway. In the context of liver regeneration c-Jun represses a post-transcriptional activity of p53 that imposes an antiproliferative state on hepatocytes by activation of p38
and subsequent p38-dependent increase in p21 protein (Fig. 7). In the absence of c-Jun, this antiproliferative state is maintained even after PH, but can be abolished by additional loss of p53. These data uncover a novel mechanistic link in the complex signaling network involving c-Jun/AP-1, p53/p21, and p38
, which is essential for regulating the restoration of liver mass following stress responses such as PH and liver injury. Future experiments will prove whether this novel molecular pathway is relevant in the control of hepatocyte proliferation during hepatocellular carcinoma formation.
| Materials and methods |
|---|
|
|
|---|
All mice used in this study were kept on a mixed background (C57Bl/6;129SV). p53 / and p21 / mice (Donehower et al. 1992
; Deng et al. 1995
) were crossed with Mx-cre c-jun f/f (Kuhn et al. 1995
; Behrens et al. 2002
) mice to obtain mice with the following genotypes: Mx-cre c-jun f/f p53 / (c-jun
li* p53 /), Mx-cre c-jun f/f p21 / (c-jun
li* p21 /), c-jun f/f p53 / (p53 /), c-jun f/f p21 / (p21 /), Mx-cre c-jun f/f p53 +/+ (c-jun
li*), Mx-cre c-jun f/f p21 +/+ (c-jun
li*), c-jun f/fp53+/+ (c-jun f/f), and c-jun f/f p21 +/+ (c-jun f/f). c-jun
li* p38
li* double-knockout mice were obtained by crossing Mx-cre c-jun f/f with p38
f/f mice (Engel et al. 2005
). Mx-cre-mediated deletion of the floxed alleles was induced by single intraperitoneal injection of poly I/C (Amersham Pharmacia Biotech, 400 µg in 200 µL PBS) into 8-to 12-wk-old animals 10 d prior to PH.
PCR genotyping and Southern blotting
The following primers were used for PCR genotyping of mice: Mx-cre: CRE1, CGGTCGATGCAACGAGTGATGAGG; CRE2, CAAGAGACGGAAATCCATCGCTCG; c-jun: LOXP5, CTCA TACCAGTTCGCACAGGCGGC; LOXP6, CCGCTAGCACT CACGTTGGTAGGC; FLOX2: CAGGCCGTTGTGTCACTG AGCT; p53: Neo19, CATTCAGGACATAGCGTTGG; X7p53, TATACTCAGAGCCGGCCT; X6.5p53, ACAGCGTGGTGG TACCTTAT; p21: Exon2F, GACAAGAGGCCCAGTACTTCC TC; Exon3R, CAATCTGCGCTTGGAGTGATAG; PGKF, GCAGCCTCTGTTCCACATACAC. Deletion of c-jun in the liver was determined by Southern blot analysis as described previously (Eferl et al. 2003
).
Partial hepatectomy
All mice used for liver regeneration experiments were between 8 and 12 wk old. Surgeries were performed between 8 and 12 a.m. under avertin anesthesia and according to a standard procedure. Briefly, the abdominal cavity was opened with a transverse incision below the rib cage and the large left lateral and median lobes were ligated and removed. The abdominal wall was closed by suture and animals were recovered on a 37°C heating block. Liver samples were collected during PH (0-h time point) and at indicated time points following the surgery. For RNA and protein analysis, liver samples were snap-frozen in liquid nitrogen. For histological analysis, livers were fixed with neutral buffered 4% PFA overnight at 4°C and stored in 70% ethanol at 4°C until further processed.
Histology and immunohistochemistry
Fixed liver tissues were embedded in paraffin, and 5-µm sections were used for immunohistochemistry. For BrdU staining, 100 µg of BrdU per gram of body weight was injected intraperitoneally 2 h before the mice were sacrificed. Positive cells were identified by immunohistochemistry with an anti-BrdU antibody (Becton/Dickinson) according to the manufacturer's recommendations. Immunohistochemical staining for Ki67 (antibody from Novocastra) was performed using the ABC staining kit (Vector Laboratories) according to the manufacturer's recommendations. The percentage of Ki67-positive cells was quantified by counting hepatocytes in 10 random fields using a 40x objective. Ki67-stained liver sections from at least three individual animals of each genotype were used for quantification. Data are shown as mean, and the error bars represent the standard deviation.
RNase protection assay (RPA)
Total RNA was isolated with the TRIZOL protocol (Invitrogen) according to the manufacturer's instructions, and 10 µg were used for each RPA reaction. RPA was performed using the Ribo-Quant multiprobe RNase protection assay system mCyc-1 and mFos/Jun (PharMingen) according to the manufacturer's protocol.
Semiquantitative PCR analysis
Semiquantitative PCR was performed with 1 µg of total RNA after cDNA synthesis using the "Ready-To-Go You-Prime It First-Strand-Beads" (Amersham Pharmacia Biotech). PCR products were analyzed by agarose gel electrophoresis or alternatively quantified by real-time PCR analysis using an Opticon2 Monitor Fluorescence Thermocycler (MJ Research). Primers sequences are available upon request.
Northern and Western blot analyses
For Northern blot analysis, 20 µg of total RNA was used, and mRNA bands for p21 and fox were detected with labeled PCR products according to standard protocols. Western blot analysis was performed according to standard procedures using the following antibodies: CyclinD1 (Zymed), CyclinE, CyclinA, PCNA, TGF
1, p38 MAP Kinase, and phospho-ERK (Santa Cruz), c-Jun and panERK (Transduction Laboratories), p21 (PharMingen), phospho-p38 MAP Kinase, phospho-MKK3/ MKK6, and MKK3 (Cell Signaling), and Tubulin (Sigma). The antibody against a proteasome subunit was a kind gift of Dr. J.M. Peters (Research Institute of Molecular Pathology, Vienna, Austria).
| Acknowledgments |
|---|
|
|
|---|
| Footnotes |
|---|
2 Present addresses: ETH Zürich (Hönggerberg), Institute of Cell Biology, Schafmattstr. 18, CH-8093 Zürich, Switzerland; ![]()
3 Ludwig Boltzmann Institute for Cancer Research (LBI-CR), Währinger Strasse 13a, A-1090 Vienna, Austria; ![]()
4 ETH Zürich (Hönggerberg), Institute of Biochemistry, Schafmattstr. 18, CH-8093 Zürich, Switzerland. ![]()
E-MAIL wagner{at}imp.univie.ac.at; FAX 43-1-7989370. ![]()
Supplemental material is available at http://www.genesdev.org.
Article is online at http://www.genesdev.org/cgi/doi/10.1101/gad.390506.
| References |
|---|
|
|
|---|
inhibit liver regeneration after partial hepatectomy. Am. J. Physiol. 263: G579G585.[Medline]Albrecht J.H., Meyer A.H., Hu M.Y. 1997. Regulation of cyclin-dependent kinase inhibitor p21(WAF1/Cip1/Sdi1) gene expression in hepatic regeneration. Hepatology 25: 557563.[CrossRef][Medline]
Albrecht J.H., Poon R.Y., Ahonen C.L., Rieland B.M., Deng C., Crary G.S. 1998. Involvement of p21 and p27 in the regulation of CDK activity and cell cycle progression in the regenerating liver. Oncogene 16: 21412150.[CrossRef][Medline]
Alderton F., Humphrey P.P., Sellers L.A. 2001. High-intensity p38 kinase activity is critical for p21(cip1) induction and the antiproliferative function of G(i) protein-coupled receptors. Mol. Pharmacol. 59: 11191128.
Behrens A., Sibilia M., David J.P., Mohle-Steinlein U., Tronche F., Schutz G., Wagner E.F. 2002. Impaired postnatal hepatocyte proliferation and liver regeneration in mice lacking c-jun in the liver. EMBO J. 21: 17821790.[CrossRef][Medline]
Borowiak M, Garratt A.N., Wustefeld T., Strehle M., Trautwein C., Birchmeier C. 2004. Met provides essential signals for liver regeneration. Proc. Natl. Acad. Sci. 101: 1060810613.
Bulavin D.V., Saito S., Hollander M.C., Sakaguchi K., Anderson C.W., Appella E., Fornace A.J. Jr. 1999. Phosphorylation of human p53 by p38 kinase coordinates N-terminal phosphorylation and apoptosis in response to UV radiation. EMBO J. 18: 68456854.[CrossRef][Medline]
Cressman D.E., Diamond R.H., Taub R. 1995. Rapid activation of the Stat3 transcription complex in liver regeneration. Hepatology 21: 14431449.[CrossRef]
Cressman D.E., Greenbaum L.E., DeAngelis R.A., Ciliberto G., Furth E.E., Poli V., Taub R. 1996. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 274: 13791383.
Deng C., Zhang P., Harper J.W., Elledge S.J., Leder P. 1995. Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell 82: 675684.[CrossRef][Medline]
Diehl A.M. 2002. Liver regeneration. Front. Biosci. 7: e301e314.
Donehower L.A., Harvey M., Slagle B.L., McArthur M.J., Montgomery C.A. Jr., Butel J.S., Bradley A. 1992. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356: 215221.[CrossRef][Medline]
Eferl R., Sibilia M., Hilberg F., Fuchsbichler A., Kufferath I., Guertl B., Zenz R., Wagner E.F., Zatloukal K. 1999. Functions of c-Jun in liver and heart development. J. Cell Biol. 145: 10491061.
Eferl R., Ricci R., Kenner L., Zenz R., David J.P., Rath M., Wagner E.F. 2003. Liver tumor development. c-Jun antagonizes the proapoptotic activity of p53. Cell 112: 181192.[CrossRef][Medline]
Engel F.B., Schebesta M., Duong M.T., Lu G., Ren S., Madwed J.B., Jiang H., Wang Y., Keating M.T. 2005. p38 MAP kinase inhibition enables proliferation of adult mammalian cardiomyocytes. Genes& Dev. 19: 11751187.
Fausto N. 2004. Liver regeneration and repair: Hepatocytes, progenitor cells, and stem cells. Hepatology 39: 14771487.[CrossRef][Medline]
FitzGerald M.J., Webber E.M., Donovan J.R., Fausto N. 1995. Rapid DNA binding by nuclear factor
B in hepatocytes at the start of liver regeneration. Cell Growth Differ. 6: 417427.[Abstract]
Greenbaum L.E., Li W., Cressman D.E., Peng Y., Ciliberto G., Poli V., Taub R. 1998. CCAAT enhancer-binding protein
is required for normal hepatocyte proliferation in mice after partial hepatectomy. J. Clin. Invest. 102: 9961007.[Medline]
Heim M.H., Gamboni G., Beglinger C., Gyr K. 1997. Specific activation of AP-1 but not Stat3 in regenerating liver in mice. Eur. J. Clin. Invest. 27: 948955.[CrossRef][Medline]
Hilberg F., Aguzzi A., Howells N., Wagner E.F. 1993. c-jun is essential for normal mouse development and hepatogenesis. Nature 365: 179181.[CrossRef][Medline]
Huang C., Ma W.Y., Maxiner A., Sun Y., Dong Z. 1999. J. Biol. Chem. 274: 1222912235.
Huh C.G., Factor V.M., Sanchez A., Uchida K., Conner E.A., Thorgeirsson S.S. 2004. Hepatocyte growth factor/cmet signaling pathway is required for efficient liver regeneration and repair. Proc. Natl. Acad. Sci. 101: 44774482.
Jascur T., Brickner H., Salles-Passador I., Barbier V., El Khissiin A., Smith B., Fotedar R., Fotedar A. 2005. Regulation of p21(WAF1/CIP1) stability by WISp39, a Hsp90 binding TPR protein. Mol. Cell 17: 237249.[CrossRef][Medline]
Johnson R.S., van Lingen B., Papaioannou V.E., Spiegel-man B.M. 1993. A null mutation at the c-jun locus causes embryonic lethality and retarded cell growth in culture. Genes & Dev. 7: 13091317.
Kim G.Y., Mercer S.E., Ewton D.Z., Yan Z., Jin K., Friedman E. 2002. The stress-activated protein kinases p38
and JNK1 stabilize p21(Cip1) by phosphorylation. J. Biol. Chem. 277: 2979229802.
Kim H., Kokkotou E., Na X., Rhee S.H., Moyer M.P., Pothoulakis C., Lamont J.T. 2005. Clostridium difficile toxin A-induced colonocyte apoptosis involves p53-dependent p21(WAF1/CIP1) induction via p38 mitogen-activated protein kinase. Gastroenterology 129: 18751888.[CrossRef]
Kobayashi K. and Tsukamoto I. 2001. Prolonged Jun N-terminal kinase (JNK) activation and the upregulation of p53 and p21(WAF1/CIP1) preceded apoptosis in hepatocytes after partial hepatectomy and cisplatin. Biochim. Biophys. Acta 1537: 7988.[Medline]
Kuhn R., Schwenk F., Aguet M., Rajewsky K. 1995. Inducible gene targeting in mice. Science 269: 14271429.
Kwak J.C., Ongusaha P.P., Ouchi T., Lee S.W. 2003. IFI16 as a negative regulator in the regulation of p53 and p21(Waf1). J. Biol. Chem. 278: 4089940904.
Li Y., Dowbenko D., Lasky L.A. 2002. AKT/PKB phosphorylation of p21Cip/WAF1 enhances protein stability of p21Cip/WAF1 and promotes cell survival. J. Biol. Chem. 277: 1135211361.
Mead J.E. and Fausto N. 1989. Transforming growth factor
may be a physiological regulator of liver regeneration by means of an autocrine mechanism. Proc. Natl. Acad. Sci. 86: 15581562.
Mitchell C., Nivison M., Jackson L.F., Fox R., Lee D.C., Campbell J.S., Fausto N. 2005. Heparin-binding epidermal growth factor-like growth factor links hepatocyte priming with cell cycle progression during liver regeneration. J. Biol. Chem. 280: 25622568.
Passegue E., Jochum W., Behrens A., Ricci R., Wagner E.F. 2002. JunB can substitute for Jun in mouse development and cell proliferation. Nat. Genet. 30: 158166.[CrossRef][Medline]
Pedraza-Alva G., Koulnis M., Charland C., Thornton T., Clements J.L., Schlissel M.S., Rincon M. 2006. Activation of p38 MAP kinase by DNA double-strand breaks in V(D)J recombination induces a G2/M cell cycle checkpoint. EMBO J. 25: 763773.[CrossRef]
Schreiber M., Kolbus A., Piu F., Szabowski A., Mohle-Steinlein U., Tian J., Karin M., Angel P., Wagner E.F. 1999. Control of cell cycle progression by c-Jun is p53 dependent. Genes & Dev. 13: 607619.
Shaulian E., Schreiber M., Piu F., Beeche M., Wagner E.F., Karin M. 2000. The mammalian UV response: c-Jun induction is required for exit from p53-imposed growth arrest. Cell 103: 897907.[CrossRef][Medline]
Takekawa M., Adachi M., Nakahata A., Nakayama I., Itoh F., Tsukuda H., Taya Y., Imai K. 2000. p53-inducible wip1 phosphatase mediates a negative feedback regulation of p38 MAPKp53 signaling in response to UV radiation. EMBO J. 19: 65176526.[CrossRef][Medline]
Taub R. 2004. Liver regeneration: From myth to mechanism. Nat. Rev. Mol. Cell Biol. 5: 836847.[CrossRef][Medline]
Timchenko N.A., Harris T.E., Wilde M., Bilyeu T.A., Burgess-Beusse B.L., Finegold M.J., Darlington G.J. 1997. CCAAT/enhancer binding protein
regulates p21 protein and hepatocyte proliferation in newborn mice. Mol. Cell. Biol. 17: 73537361.[Abstract]
Wu H., Wade M., Krall L., Grisham J., Xiong Y., Van Dyke T. 1996. Targeted in vivo expression of the cyclindependent kinase inhibitor p21 halts hepatocyte cell-cycle progression, postnatal liver development and regeneration. Genes & Dev. 10: 245260.
Yamada Y., Kirillova I., Peschon J.J., Fausto N. 1997. Initiation of liver growth by tumor necrosis factor: Deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc. Natl. Acad. Sci. 94: 14411446.
Zhang Z., Wang H., Li M., Agrawal S., Chen X., Zhang R. 2004. MDM2 is a negative regulator of p21WAF1/CIP1, independent of p53. J. Biol. Chem. 279: 1600016006.
![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
K. J. Riehle, J. S. Campbell, R. S. McMahan, M. M. Johnson, R. P. Beyer, T. K. Bammler, and N. Fausto Regulation of liver regeneration and hepatocarcinogenesis by suppressor of cytokine signaling 3 J. Exp. Med., January 21, 2008; 205(1): 91 - 103. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Natarajan, B. Wagner, and M. Sibilia The EGF receptor is required for efficient liver regeneration PNAS, October 23, 2007; 104(43): 17081 - 17086. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hasselblatt, M. Rath, V. Komnenovic, K. Zatloukal, and E. F. Wagner Hepatocyte survival in acute hepatitis is due to c-Jun/AP-1-dependent expression of inducible nitric oxide synthase PNAS, October 23, 2007; 104(43): 17105 - 17110. [Abstract] [Full Text] [PDF] |
||||